ID: 962695816

View in Genome Browser
Species Human (GRCh38)
Location 3:137946071-137946093
Sequence ACCTTTCGCTTGCAATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695808_962695816 4 Left 962695808 3:137946044-137946066 CCCTACCAAGTCTCCCCTCCAGA No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695810_962695816 -1 Left 962695810 3:137946049-137946071 CCAAGTCTCCCCTCCAGAAGCCA No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695811_962695816 -9 Left 962695811 3:137946057-137946079 CCCCTCCAGAAGCCACCTTTCGC No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695807_962695816 25 Left 962695807 3:137946023-137946045 CCTATAACTACTAGGATGACTCC No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695809_962695816 3 Left 962695809 3:137946045-137946067 CCTACCAAGTCTCCCCTCCAGAA No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data
962695812_962695816 -10 Left 962695812 3:137946058-137946080 CCCTCCAGAAGCCACCTTTCGCT No data
Right 962695816 3:137946071-137946093 ACCTTTCGCTTGCAATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695816 Original CRISPR ACCTTTCGCTTGCAATGTCC TGG Intergenic