ID: 962695817

View in Genome Browser
Species Human (GRCh38)
Location 3:137946072-137946094
Sequence GCCAGGACATTGCAAGCGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695817_962695819 -5 Left 962695817 3:137946072-137946094 CCTTTCGCTTGCAATGTCCTGGC No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962695817 Original CRISPR GCCAGGACATTGCAAGCGAA AGG (reversed) Intergenic