ID: 962695819

View in Genome Browser
Species Human (GRCh38)
Location 3:137946090-137946112
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962695813_962695819 8 Left 962695813 3:137946059-137946081 CCTCCAGAAGCCACCTTTCGCTT No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695817_962695819 -5 Left 962695817 3:137946072-137946094 CCTTTCGCTTGCAATGTCCTGGC No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695814_962695819 5 Left 962695814 3:137946062-137946084 CCAGAAGCCACCTTTCGCTTGCA No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695815_962695819 -2 Left 962695815 3:137946069-137946091 CCACCTTTCGCTTGCAATGTCCT No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695812_962695819 9 Left 962695812 3:137946058-137946080 CCCTCCAGAAGCCACCTTTCGCT No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695810_962695819 18 Left 962695810 3:137946049-137946071 CCAAGTCTCCCCTCCAGAAGCCA No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695808_962695819 23 Left 962695808 3:137946044-137946066 CCCTACCAAGTCTCCCCTCCAGA No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695809_962695819 22 Left 962695809 3:137946045-137946067 CCTACCAAGTCTCCCCTCCAGAA No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data
962695811_962695819 10 Left 962695811 3:137946057-137946079 CCCCTCCAGAAGCCACCTTTCGC No data
Right 962695819 3:137946090-137946112 CTGGCTTTCAGATGCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type