ID: 962699135

View in Genome Browser
Species Human (GRCh38)
Location 3:137979670-137979692
Sequence CAGCTGACACCCACCCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962699135_962699139 11 Left 962699135 3:137979670-137979692 CCTCCATGGGTGGGTGTCAGCTG No data
Right 962699139 3:137979704-137979726 GTTTTGTTTTCTGTTATCAAAGG No data
962699135_962699140 12 Left 962699135 3:137979670-137979692 CCTCCATGGGTGGGTGTCAGCTG No data
Right 962699140 3:137979705-137979727 TTTTGTTTTCTGTTATCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962699135 Original CRISPR CAGCTGACACCCACCCATGG AGG (reversed) Intergenic
No off target data available for this crispr