ID: 962702243

View in Genome Browser
Species Human (GRCh38)
Location 3:138010789-138010811
Sequence CCCTGCTCCCATGTATGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962702243_962702246 9 Left 962702243 3:138010789-138010811 CCTGCACATACATGGGAGCAGGG 0: 1
1: 0
2: 1
3: 21
4: 160
Right 962702246 3:138010821-138010843 GCTGAGTATTTTGTTATATCTGG 0: 1
1: 0
2: 2
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962702243 Original CRISPR CCCTGCTCCCATGTATGTGC AGG (reversed) Intronic
900002951 1:25008-25030 CCCTACTCCCCTATCTGTGCAGG - Intergenic
900022672 1:195533-195555 CCCTACTCCCCTATCTGTGCAGG - Intergenic
900928379 1:5720148-5720170 CCCTGATGCCATGGAGGTGCAGG + Intergenic
902197612 1:14809423-14809445 TCCTGCTCACACCTATGTGCCGG + Intronic
905251098 1:36648980-36649002 CCCAGCCCCCATGCATGTCCTGG + Intergenic
905382500 1:37572978-37573000 CCCTGCTGGAATATATGTGCAGG + Intronic
905901670 1:41585515-41585537 CCCCGCTCCCATGTCAGTGTTGG + Intronic
907046557 1:51303358-51303380 CCCTTCTCCCAGGAATGTGCTGG - Intronic
908414147 1:63896412-63896434 GCCTTCTCCAAAGTATGTGCTGG + Intronic
910423854 1:87099984-87100006 CCCTGCCCCCATGGCTTTGCAGG + Intronic
910524168 1:88158227-88158249 CCGTGGTCCTATGTATTTGCTGG - Intergenic
910879026 1:91905842-91905864 CTCTGCTTCCTTGTGTGTGCTGG + Intronic
920347100 1:205313555-205313577 CCCTGCTCCCTGGTATTTTCTGG - Intronic
922062630 1:222106701-222106723 CCCAGCTCCCCTGCATGAGCTGG - Intergenic
922701518 1:227763869-227763891 CCCCGCTCCCAGGCAGGTGCAGG + Intronic
1067668378 10:48298369-48298391 CCCTACGCCCACGTGTGTGCTGG + Intergenic
1067993589 10:51243465-51243487 CCCTGCTGTGGTGTATGTGCAGG + Intronic
1069895749 10:71679158-71679180 CCCTGCTCCCCTCCATGTGCTGG - Intronic
1074432867 10:113408608-113408630 CCCACCTCCAATGTATGCGCTGG + Intergenic
1074534763 10:114320799-114320821 CCCTGCTCCCAGGTGTGGCCGGG - Intronic
1076843224 10:133056815-133056837 CCCTGCCCCCAGGCACGTGCAGG - Intergenic
1078025153 11:7688096-7688118 CACAGCTCCCATGTCTGTCCTGG + Intergenic
1081693714 11:45095012-45095034 CCCTGCCCCCATGCCTGTGCTGG - Intergenic
1083094331 11:60233906-60233928 CCCTGCTCCCATATCTTTGCTGG - Intronic
1083099452 11:60287971-60287993 TCCTGCTCCCATATCTTTGCTGG + Intronic
1083857488 11:65400362-65400384 CCCTGCTGCCATCTGTGTCCTGG + Intronic
1085128467 11:74017946-74017968 CCCTGCTTCCAAGTATCTGAGGG + Intronic
1085279818 11:75322593-75322615 CCCTGCCCCCATGTCCCTGCTGG - Intronic
1091376370 12:27071-27093 CCCTACTCCCCTATCTGTGCAGG - Intergenic
1091555695 12:1571888-1571910 CCCTGCACCCAGGAAAGTGCTGG - Intronic
1091620958 12:2088685-2088707 ACCTCCTCCCATGTATCTGAAGG + Intronic
1091963024 12:4714745-4714767 CCCCTCTCCCATGGATTTGCGGG + Intronic
1092254099 12:6916875-6916897 CCCTGCTCCCATGGGAGTTCAGG + Intronic
1094840945 12:34342511-34342533 CCCCGCTGCCATGCATGTGCGGG + Intergenic
1100856387 12:98761192-98761214 CATTGCTCTCATGAATGTGCTGG + Intronic
1102014538 12:109639066-109639088 CCCTGCTCCCAGCTCAGTGCTGG + Intergenic
1106086237 13:26544440-26544462 CACTGACCCCATGTTTGTGCAGG - Intergenic
1108690719 13:52857072-52857094 CCCTAGTCCCCTGAATGTGCAGG - Intergenic
1109904195 13:68816844-68816866 CCTAGATCCCTTGTATGTGCAGG + Intergenic
1112566039 13:100552046-100552068 CCCTTCTCCCAGCCATGTGCAGG + Intronic
1117305364 14:54468560-54468582 CCCTGCCCCCATGGCTTTGCTGG - Intergenic
1120743625 14:88134192-88134214 CTTTGCTCCCATCTCTGTGCTGG - Intergenic
1120840386 14:89080404-89080426 CCCTGCTCTCTTGAATGTGGTGG + Intergenic
1121277194 14:92676503-92676525 GCCTGTGCTCATGTATGTGCTGG + Exonic
1121511470 14:94516064-94516086 CTTTGCTCCAATGTGTGTGCTGG + Exonic
1122285440 14:100649026-100649048 CCCTGCCCCCATGGCTGTGCTGG - Intergenic
1122885252 14:104707781-104707803 CCCTGCTGCCTGGTATGGGCTGG + Exonic
1125613126 15:40986119-40986141 CCCTCCTCCCATGTGTTTTCTGG - Intronic
1127770588 15:62226991-62227013 CCCTTCTCCCATGCATGTCTAGG + Intergenic
1128586250 15:68852898-68852920 CCCAGCTCCCATGTGAATGCCGG - Intronic
1129263426 15:74381624-74381646 CACCGCTCCCATGTCTCTGCTGG + Intergenic
1132450556 15:101965931-101965953 CCCTACTCCCCTATCTGTGCAGG + Intergenic
1133913633 16:10088367-10088389 CCCTGCCTCCCTGTATGTCCTGG - Intronic
1135487003 16:22874507-22874529 CCATGCTTCCATGTGTGTCCTGG + Intronic
1138501517 16:57447745-57447767 CCCTGCTCCGCTGTCTGTGAGGG + Intronic
1138576535 16:57911046-57911068 CACTGCTACCATGGAGGTGCTGG - Intronic
1140477092 16:75244442-75244464 CCCTCCTCCCCTATATGAGCAGG + Intronic
1140906304 16:79412298-79412320 CCGTGGTACCAGGTATGTGCAGG + Intergenic
1141785210 16:86195077-86195099 GCCTGCACCCATGCATGTGCCGG - Intergenic
1142954282 17:3510658-3510680 CCATTCTCCCTTGAATGTGCCGG - Intronic
1147163763 17:38582493-38582515 CCCTGCTTCCCTGTCTGTGCAGG - Intronic
1150173387 17:63023239-63023261 CCCAGCTCCCATGACTTTGCTGG - Intronic
1150295668 17:64006050-64006072 CACTGCCCCCAAGTATCTGCAGG - Intronic
1152773586 17:82186133-82186155 CCATGATCCCAAGTATGAGCTGG - Intronic
1152799108 17:82322847-82322869 CCCTGCACCCCAGTTTGTGCGGG - Intronic
1152898712 17:82928127-82928149 CCCTGACCCCAGGTTTGTGCAGG + Intronic
1153138211 18:1941780-1941802 CCCTGCCCCCATGGCTTTGCTGG - Intergenic
1154381042 18:13850078-13850100 TCCTGCTCCCATGCCTGGGCTGG + Intergenic
1160634702 19:66616-66638 CCCTACTCCCCTATCTGTGCAGG - Intergenic
1160902286 19:1434533-1434555 CCCTGCTCACATGTTTTTGAGGG + Intronic
1161170139 19:2808433-2808455 CTCTGCTCCCAGGTGGGTGCGGG + Exonic
1162590098 19:11585805-11585827 CCATGCCCCCATGTTTGTGATGG + Intronic
1163821622 19:19499481-19499503 CGCTGCTCCCAAGTCTGTGCTGG - Intronic
1164908066 19:31983847-31983869 CTCTGCTCCCAGGCAGGTGCAGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167998154 19:53423430-53423452 CGCTGGTCCTATGAATGTGCTGG - Intronic
1168007631 19:53504024-53504046 CGCTGGTCCTATGAATGTGCTGG - Intergenic
924998767 2:387001-387023 CCCTGCTCCCTTCTCTGTCCTGG + Intergenic
925876481 2:8315640-8315662 CCCTGCTCCCTGGAATTTGCTGG + Intergenic
926088761 2:10036604-10036626 CCCTGCTGCCCTGTCTGCGCTGG + Intergenic
927847839 2:26480470-26480492 CCCTGCTTCCATGGATATCCAGG - Intronic
929055136 2:37870024-37870046 CCCTGCTGCCATCTCTGTGCTGG - Intergenic
931181421 2:59905060-59905082 TCCTGCTCCCATGGATTTTCTGG + Intergenic
932571602 2:72941193-72941215 CCCCGCTCCCAGGTGTGTGGGGG - Intergenic
935219693 2:101002002-101002024 CCCTGCTCCCATACATCTGTAGG + Intronic
936566775 2:113588411-113588433 CCCTACTCCCCTATCTGTGCAGG + Intergenic
937222622 2:120350526-120350548 CCCTGCTCCCAGGTCTCTGACGG - Exonic
940372485 2:152918488-152918510 CCCTGCCCCCATGGCTTTGCTGG - Intergenic
941481608 2:166022617-166022639 CCCTGCCCTTATGTATGGGCAGG + Intronic
942731677 2:179067106-179067128 CCCTGATCCCTTGTATTTCCTGG + Intergenic
942762089 2:179411513-179411535 CCCAGCTCCCAAGTTTGTGATGG + Intergenic
946542067 2:220695630-220695652 CCCTGTCCCCATCCATGTGCAGG + Intergenic
949061426 2:241960437-241960459 CCCTGCTGCCATCTCTGTGCTGG + Intergenic
1170759713 20:19238945-19238967 GCATGCGCCCATGTGTGTGCTGG - Intronic
1174064139 20:47852609-47852631 TCCTGTGGCCATGTATGTGCTGG + Intergenic
1175416431 20:58804354-58804376 CCAGGCTCCCACGCATGTGCAGG + Intergenic
1179245008 21:39625495-39625517 CCCCGCTCCCAACTATGTGCAGG + Intronic
1182896732 22:33865110-33865132 CTCTGCTTCCACGTCTGTGCAGG + Intronic
1183073721 22:35413476-35413498 CCTGGCTCCCCTGCATGTGCTGG - Intronic
1184762325 22:46551572-46551594 CCCTGCTCCCATGCTGCTGCAGG + Intergenic
951090341 3:18565524-18565546 CCCTGCACCCATGTATTCCCTGG + Intergenic
954410081 3:50366722-50366744 CCCTGCCTCCATGTAGGTGTTGG + Intronic
954618579 3:51983190-51983212 TCCTGCCCCCAGGTATGCGCCGG - Exonic
954845631 3:53553056-53553078 CCCTGCTTTCATGCACGTGCAGG - Intronic
955444823 3:58998600-58998622 CCCTGCTCCTATCTTTGTGGAGG + Intronic
955522421 3:59787898-59787920 CCTAGCTACCATCTATGTGCTGG + Intronic
957876173 3:86149260-86149282 CCCTGCTCCCCTGGATGTAGAGG - Intergenic
959310458 3:104729513-104729535 CCCTGCTCTCATGGATTTGTTGG + Intergenic
960093420 3:113665149-113665171 CCCTTTTCCCATATATCTGCAGG - Intronic
960754920 3:121001096-121001118 CCATGCCCACATGCATGTGCTGG + Intronic
962702243 3:138010789-138010811 CCCTGCTCCCATGTATGTGCAGG - Intronic
964231087 3:154468827-154468849 CCTTGCTCCCATTTATCTTCAGG + Intergenic
966912679 3:184568353-184568375 CCGTCCTGCCATGTATCTGCAGG - Intronic
968205972 3:196800869-196800891 CACTCCTGCCCTGTATGTGCTGG - Intronic
968922106 4:3527634-3527656 CCATGCTCTCAAGTGTGTGCTGG + Intronic
969717220 4:8873541-8873563 CCCTGCTCCCTGGGATGTCCAGG + Intergenic
970038660 4:11770733-11770755 CCCTGCTGCCATTGATGTGATGG - Intergenic
971248772 4:24954229-24954251 CCCTGCCCCCATGGCTTTGCTGG + Intronic
972930306 4:44063977-44063999 CCCTACTCCCATGGCTTTGCTGG - Intergenic
974142381 4:57903600-57903622 CCCTTCTCCCAGATCTGTGCAGG - Intergenic
974456165 4:62131278-62131300 CCCTGCTACCACATATGTGCTGG + Intergenic
974893934 4:67915449-67915471 CCCTCCTCCCAAATATGGGCAGG + Intronic
977130195 4:93226556-93226578 CCCTGCTCCCAGGGCTTTGCTGG + Intronic
984236072 4:177160147-177160169 CCCTCCTCCCATGACTTTGCTGG + Intergenic
984950607 4:185004937-185004959 ACCTGCTCCCAAGTGTGTGAGGG + Intergenic
985041396 4:185894971-185894993 CCATGCTGCCATGTATGGCCAGG + Intronic
985754916 5:1707787-1707809 CCCTGCTCCCATCTTGGGGCTGG + Intergenic
985905252 5:2830233-2830255 CCCTGATCCCATGTGGGGGCTGG - Intergenic
990061341 5:51652993-51653015 CCCTGTTCTCTAGTATGTGCAGG + Intergenic
991453831 5:66781272-66781294 CCCTGCTCCCAGGTTAGTGGTGG + Intronic
993107188 5:83612564-83612586 CCCTGCTCCCATGGCTTTGCTGG - Intergenic
995851815 5:116554176-116554198 ATCTGTTCCCATCTATGTGCCGG - Intronic
998399573 5:141841593-141841615 CCCTGCTGCCCTGCATCTGCTGG + Intergenic
1002070132 5:176674157-176674179 CCCTGCCCCCTTGGCTGTGCTGG - Intergenic
1002601498 5:180356400-180356422 CCCTGCTCCCCTGTAAGCACAGG - Intergenic
1003142494 6:3483034-3483056 CGCTGCTCCAAGGTATGTCCAGG - Intergenic
1006810508 6:36817589-36817611 CCATGCTCCTCTGTCTGTGCTGG + Intronic
1008877167 6:56341805-56341827 CCCTGCCACCATGTATGCACAGG - Intronic
1013375465 6:109509983-109510005 CCCTACTCCCATCTCTGAGCAGG + Intronic
1013573671 6:111456311-111456333 CTCTGTTCTCAAGTATGTGCTGG + Intronic
1016890230 6:148998806-148998828 GGCTGCTGCCATGTATGTGCTGG + Intronic
1018669572 6:166167734-166167756 CCCTCCTCCCGGGTCTGTGCCGG - Exonic
1018993910 6:168695957-168695979 CCCTGCTCACAGGCATGGGCTGG + Intergenic
1019171204 6:170134224-170134246 CCCTGATCCCCTGCATGTGATGG - Intergenic
1019198964 6:170298219-170298241 CCCTGCTCCAATAAATGGGCTGG + Intronic
1019617750 7:1973899-1973921 CACTGCTCCTGTGTCTGTGCTGG - Intronic
1019664327 7:2243880-2243902 TCCTGCTCCCATAGGTGTGCAGG - Intronic
1019721316 7:2573675-2573697 CTCTGCTGCCTTTTATGTGCTGG - Intronic
1019814541 7:3189935-3189957 CACAGCTCCCATGTATGTGCTGG + Intergenic
1021019930 7:15585007-15585029 CTCTGCTCCCATGTCTCTGCAGG - Intergenic
1022451565 7:30520721-30520743 GCCTGGTCCCTTTTATGTGCTGG + Intronic
1023599135 7:41864537-41864559 CCCTGTTCCCATGGCTTTGCTGG + Intergenic
1024276227 7:47679175-47679197 CCCTGCTCCCATGGCTTTGCGGG - Intergenic
1024628653 7:51229985-51230007 CCCTGCTGCCTTATCTGTGCAGG + Intronic
1024975914 7:55113448-55113470 CCCCTCTCCCATGTGTTTGCAGG + Intronic
1027234409 7:76289554-76289576 CCCTGCTCCCACTTCTGTGTGGG + Intergenic
1029865417 7:103622501-103622523 CCCTGCTCCAAATTATTTGCTGG + Intronic
1030363344 7:108618708-108618730 CCCAGCTCCTGTGTATGAGCAGG - Intergenic
1032455926 7:132073454-132073476 AGCTCCTGCCATGTATGTGCAGG - Intergenic
1033246443 7:139720361-139720383 CCCTGGGCCCATGGATCTGCTGG + Intronic
1037009113 8:13819032-13819054 CCCTGCTCCCATGGCTTTGCTGG + Intergenic
1038496906 8:28009955-28009977 CCCTGCTCCCCTGTAGCTGGTGG + Intergenic
1039124157 8:34182095-34182117 CCCTGCTCCTTTGAATGTCCAGG - Intergenic
1042823756 8:72959785-72959807 CCCTGCTCAGGTGTATGTGTGGG - Intergenic
1044028969 8:87211013-87211035 CTCTGCCCCCATGTCTCTGCAGG - Intronic
1044871016 8:96619999-96620021 CCGTTCTCCCATTTATGTGAAGG + Intergenic
1048013077 8:130474132-130474154 CCTTGGTCCCATGGATGGGCTGG + Intergenic
1048122889 8:131601375-131601397 AACTGCTCCCATGCATTTGCTGG - Intergenic
1049785472 8:144448675-144448697 AGCTGCTCCCAAGGATGTGCTGG + Intergenic
1049885755 9:25121-25143 CCCTACTCCCCTATCTGTGCAGG - Intergenic
1052963366 9:34319499-34319521 CCTTGCTCCCATAGATGTCCTGG - Intronic
1055372614 9:75616559-75616581 CCATCTTCCCATGTATCTGCTGG - Intergenic
1058899197 9:109427150-109427172 CCCTGCTCCTATGTCTGTGTGGG - Intronic
1060584939 9:124779972-124779994 CCCTGGACCCCTGAATGTGCTGG - Intronic
1060888464 9:127173005-127173027 CCCTCCTCCCATGTGTGTGAGGG + Intronic
1061063039 9:128260314-128260336 CCCTGCTCCGATGGCTGTGGGGG - Intronic
1061198328 9:129121030-129121052 CCCAGCTCCCAGGTATTTGCAGG - Intronic
1062091736 9:134682043-134682065 CCCTGGTCCCTTGGCTGTGCAGG + Intronic
1062384965 9:136305567-136305589 CCCTGCTCCCATGAAGGGACAGG + Intronic
1185582750 X:1223681-1223703 CCCAGCTTCCAGGTATGTGAAGG - Intergenic
1188265741 X:28071635-28071657 CCTTTCTCCAATGTATGTTCTGG - Intergenic
1188528132 X:31107932-31107954 CCCTGCCCCCATGGCTTTGCTGG - Intronic
1200008180 X:153101778-153101800 CCCTGTTCCCATGACTTTGCTGG + Intergenic