ID: 962702301

View in Genome Browser
Species Human (GRCh38)
Location 3:138011564-138011586
Sequence AAAGAGAACCAGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 502}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962702294_962702301 17 Left 962702294 3:138011524-138011546 CCTGCTTAGGGAAGCAAGGGAGG 0: 1
1: 0
2: 2
3: 27
4: 219
Right 962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 502
962702291_962702301 28 Left 962702291 3:138011513-138011535 CCGGGGAAAGACCTGCTTAGGGA 0: 1
1: 0
2: 4
3: 13
4: 169
Right 962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 502

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962702301 Original CRISPR AAAGAGAACCAGACTGAGGA GGG Intronic
900098223 1:949052-949074 AAAGAGTGCCAGACACAGGACGG + Intronic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
900762982 1:4485407-4485429 GAGAAGAACCAGACTGAAGAAGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
902199790 1:14824788-14824810 ACAGAGAACCAGATAGAAGAAGG - Intronic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
902732287 1:18377353-18377375 AAAGAGAACCAAAGGGTGGATGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903117663 1:21191483-21191505 AAAGAAAAAGAGACTGAAGAAGG - Intergenic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904563552 1:31413931-31413953 AGCGCGAGCCAGACTGAGGACGG - Intronic
905018698 1:34794075-34794097 AAAGAAACCCAGGCTCAGGAAGG - Intronic
906841533 1:49144720-49144742 AAAGGGAGACAGACTGAGCAGGG + Intronic
906963499 1:50434111-50434133 GAAGAGCAGCAAACTGAGGAAGG + Intergenic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
908411243 1:63867844-63867866 AAAGAGAAGCAGATCAAGGAAGG - Intronic
909721729 1:78778674-78778696 AAAGAGCGCCAGACAGAGGAAGG - Intergenic
910496953 1:87840624-87840646 AAAGACATCCAGGCTGAGGATGG - Intergenic
910599483 1:89015630-89015652 AAATAGAAAAAAACTGAGGAAGG + Intronic
911123504 1:94319194-94319216 AAAGAGAAAGAAACTGTGGAGGG - Intergenic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
913391599 1:118320079-118320101 AAAAAAAATCAGACTGATGAAGG - Intergenic
913645313 1:120849311-120849333 AAAGAGAAAACTACTGAGGAAGG - Intergenic
914081416 1:144414228-144414250 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914176325 1:145282767-145282789 AAAGAGAAAACTACTGAGGAAGG + Intergenic
914531052 1:148524253-148524275 AAAGAGAAAACTACTGAGGAAGG + Intergenic
915743435 1:158137813-158137835 AAAGTGAAAAAGACTGAGGGTGG - Intergenic
915802275 1:158807108-158807130 AGAGAGAATGAGGCTGAGGAGGG + Intergenic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915906367 1:159880770-159880792 AGAGAGATGCAGACAGAGGAGGG + Intronic
916117793 1:161502470-161502492 AACTAGAACCCCACTGAGGAAGG + Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916344464 1:163772240-163772262 GAAGAGAAGCAGATTGGGGAGGG + Intergenic
916934292 1:169611699-169611721 AAAGAGAAAGATACTGAGAAAGG + Intronic
917020206 1:170578790-170578812 AAAGGGAAACAGACAGAGAAGGG - Intergenic
918203438 1:182288498-182288520 AAGGAGCACCAGCCTTAGGATGG + Intergenic
918209090 1:182335021-182335043 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
919123344 1:193367866-193367888 CAAGAGAACCAGAATTAGAAGGG - Intergenic
919593269 1:199530588-199530610 AAAGGGAACAAGAGTGAGGATGG - Intergenic
920267734 1:204736955-204736977 CAAGAGAACCAGACTGTAGCAGG + Intergenic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
921948123 1:220902383-220902405 AAAGAAAACCCAACTGAAGATGG + Intergenic
922195555 1:223356951-223356973 AAAAAGAACCACTCTTAGGAAGG + Intronic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
924328050 1:242915127-242915149 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1063737151 10:8771221-8771243 AAAGAGTCCCAGACTGAAGAAGG + Intergenic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1066277985 10:33887529-33887551 CTAGAGACCCAGACTGAGGTTGG - Intergenic
1068148724 10:53104779-53104801 AGAGAGAAAGAGACAGAGGAGGG + Intergenic
1068803862 10:61172721-61172743 AAAGAGAAAGAGAAAGAGGAAGG + Intergenic
1069003022 10:63286596-63286618 AAAGAGCTACATACTGAGGATGG - Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069377562 10:67809269-67809291 AAAGAGACCCAGGGTGTGGATGG - Intronic
1069567817 10:69475118-69475140 AAAGAAAACCAGGGGGAGGAGGG + Intronic
1069646751 10:70005226-70005248 AGAGAGAGCCAGAGAGAGGAAGG + Intergenic
1070430995 10:76337487-76337509 AAAGTGGTCCAGGCTGAGGAAGG + Intronic
1071230399 10:83579557-83579579 AAAAAGAACAAGAATGAAGAGGG + Intergenic
1072073948 10:91949737-91949759 AAAGAGAGCCAGAGAGAAGAGGG - Intronic
1072747091 10:97948366-97948388 GAGGAGAGCTAGACTGAGGAGGG + Intronic
1072760688 10:98054078-98054100 AGAGAGAAACAGACTGAGAGAGG - Intergenic
1073186019 10:101615469-101615491 AATGAGACACAGGCTGAGGAGGG + Intronic
1073257989 10:102167197-102167219 AAAGCAAACAAGACTGAGAAGGG - Intergenic
1074134412 10:110614427-110614449 AAAGAGAACCATGGTGAAGACGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075721608 10:124590765-124590787 ACAGAGAAGCAGGCTCAGGAAGG - Intronic
1077618494 11:3697113-3697135 AAATAGTACCAGACGGAGGCTGG + Intronic
1078170776 11:8927440-8927462 AAAGAAAACCAGGCAAAGGAAGG - Intronic
1078394921 11:10972559-10972581 AGAGAGAAACAAACTGAGAATGG + Intergenic
1078423745 11:11233042-11233064 AAATAGAGGGAGACTGAGGATGG + Intergenic
1079306448 11:19327832-19327854 AATGACAGCCAGACTGAGGTTGG - Intergenic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080622578 11:33998945-33998967 AAAAAGAACCAGACCAAGGATGG - Intergenic
1080798404 11:35587254-35587276 CAAGAGACCCAGATTGAGTATGG + Intergenic
1081386405 11:42478430-42478452 AAAGGGAACCAGGCTTAGGGAGG - Intergenic
1081489283 11:43554871-43554893 CAAGAGAACCTATCTGAGGAGGG + Intergenic
1081747228 11:45481784-45481806 AAAGAGAGCCAGAGAAAGGAAGG - Intergenic
1083082031 11:60104026-60104048 AAACAGAAGTAGACTGTGGATGG - Intergenic
1083177202 11:60957994-60958016 AAAGAGAACAAGAGAGAGAAGGG + Intergenic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086577543 11:88357434-88357456 AAAGAGAAACTGACTTAGGTAGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1088072064 11:105799331-105799353 AAAAAGAAAGAAACTGAGGATGG + Intronic
1088207283 11:107407605-107407627 GAATAGAAGCAAACTGAGGAAGG + Intronic
1088713311 11:112527367-112527389 AGAGAAATCCAGCCTGAGGAAGG + Intergenic
1089711643 11:120319130-120319152 AAAGAGAAACACAGGGAGGAAGG - Exonic
1090178172 11:124670578-124670600 AAAGAGAACCAGAATTAACAAGG + Intronic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1091048875 11:132350012-132350034 AAAGAAACCAAGACTCAGGAAGG + Intergenic
1091057145 11:132429930-132429952 AGCTAGAAGCAGACTGAGGAAGG + Intronic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1093182816 12:15987118-15987140 AAAGAAAACCATACTTAGGTCGG - Intronic
1093888861 12:24495309-24495331 AAAGAGAACCAGTATGAAGTAGG + Intergenic
1093919089 12:24839227-24839249 AAGGAAAGCCAGACTGAGAATGG + Intronic
1095562221 12:43579061-43579083 ACAGAGAACGAGACTGATGTAGG + Intergenic
1096016365 12:48279516-48279538 AAAGAGAGGCAGAGGGAGGATGG - Intergenic
1096623932 12:52881559-52881581 AAAGAGAACCATTCAAAGGAGGG + Intergenic
1096628203 12:52907880-52907902 AGAGAGAACCAGACTGGAGCAGG + Intronic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1098170878 12:67745917-67745939 AAAGAGAAACAGACAGAGAAGGG - Intergenic
1100320099 12:93482879-93482901 AAAAAGAACCAGATTGGGCAAGG - Intronic
1100812161 12:98350006-98350028 TAAGAGCACCAGACAGAGGTAGG - Intergenic
1102442049 12:112970976-112970998 AGAGAGAAACAGGCTGAGCACGG - Exonic
1103158753 12:118709714-118709736 ACAGTGCACCAGACTGAGTACGG - Intergenic
1103611938 12:122129391-122129413 AAAGACAACCTGACCGAGGCAGG - Intronic
1103832470 12:123790749-123790771 AAAGAGGACAGGAGTGAGGAAGG + Intronic
1104026604 12:125032110-125032132 GAAGGAAACCAGAATGAGGAGGG + Intergenic
1104371877 12:128230696-128230718 AAAGACAACCAGAGAGAGGAGGG + Intergenic
1104486027 12:129151751-129151773 GAAGAGAAGCAGACAGAAGACGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104881735 12:132076201-132076223 TGAAAGAATCAGACTGAGGATGG - Intronic
1105509334 13:21038118-21038140 AAAACAAATCAGACTGAGGAGGG + Intronic
1105809114 13:23979239-23979261 AAAGAGATCCTGACTGAAGTGGG - Intergenic
1107216847 13:37931669-37931691 AAAGAGAAAGAGAATGAAGAGGG - Intergenic
1107703789 13:43078066-43078088 AATGGGAACCAGACTGTGGATGG - Intronic
1108108252 13:47036871-47036893 AATGAGACCTAGACTGAGGAAGG + Intergenic
1109599567 13:64606724-64606746 AAAAAGAACCAGAGAGTGGAAGG + Intergenic
1109910795 13:68907491-68907513 AAAGAGAAACAGACTATAGAGGG - Intergenic
1109985120 13:69970777-69970799 AAACAGAAGCAGGCAGAGGAAGG - Intronic
1110495805 13:76166406-76166428 AAAAAAAACCAGATTGATGAAGG + Intergenic
1111027146 13:82542866-82542888 AAAGAGAAAGAGAGAGAGGAGGG + Intergenic
1111240345 13:85465512-85465534 AAAAAGAACCAGACAGAAGGAGG - Intergenic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1113245138 13:108386798-108386820 AGAGAGAATCAGAATAAGGATGG - Intergenic
1113341961 13:109434460-109434482 AAAGAGAGAGAGACTGAGGCAGG + Intergenic
1113467712 13:110524008-110524030 AAAGTGGACCTCACTGAGGAGGG - Exonic
1114980093 14:28152367-28152389 AAAGAAAACAAAACTGAGCAGGG + Intergenic
1115183919 14:30662813-30662835 AAAGAAAACAAGACTGCTGAAGG + Intronic
1115452402 14:33563178-33563200 AAAGAAAATAAAACTGAGGAAGG - Intronic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1117867698 14:60166492-60166514 AAAGAAAACAACACTGGGGAGGG - Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118668423 14:68095992-68096014 AAAAAGAAACAGACTCAGAAAGG + Intronic
1120072520 14:80120057-80120079 AAAGAGAAGCAGAGTCAGGTGGG - Intergenic
1121290026 14:92766587-92766609 AATGAGAACCAGCCTGAGAGGGG + Intergenic
1121400256 14:93669911-93669933 AAAGATAACCAGACATATGAGGG + Intronic
1121734615 14:96209361-96209383 AAAGAGAAACTGACTGAAGCAGG + Intronic
1122286542 14:100655789-100655811 GGAGAGCACCAGAGTGAGGAGGG - Intergenic
1122843719 14:104479257-104479279 CAAGAGCACCAGCCTGAGCATGG + Intronic
1122861747 14:104585633-104585655 AGAGAGAATCAGAGAGAGGAAGG + Intronic
1124079457 15:26477917-26477939 AAAGAGAAACAGAGTGAAAATGG + Intergenic
1124553489 15:30705352-30705374 AAAGAGAACAAGACTAGAGAGGG + Intronic
1124620290 15:31270166-31270188 AAAGAGAAAGAGAGTGAGCAGGG + Intergenic
1124677756 15:31700316-31700338 AAAGAGAACAAGACTAGAGAGGG - Intronic
1125228277 15:37421351-37421373 AAAGAGTAACAGACTCAGAAAGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126431918 15:48594996-48595018 AAAGAGAAGCAGTTTAAGGAGGG + Intronic
1127001358 15:54510786-54510808 AAAGAGAAATAGACAAAGGAAGG - Intronic
1128237906 15:66080044-66080066 AAAGAGAAGGAGACAGAGGCTGG + Intronic
1128290946 15:66477854-66477876 AAATGGAACGAGACTGAGAAGGG - Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128449136 15:67792004-67792026 ACAGAGCACCAGGCAGAGGAGGG + Intronic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1129050526 15:72777956-72777978 AAAAAAAACCAGGCTGAGCACGG + Intronic
1129186701 15:73911672-73911694 AGAGAGAACCTGATTGAGGGAGG - Intergenic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129888003 15:79052148-79052170 AAAGAAAGCCAGTCTGAGGGTGG - Intronic
1130018096 15:80202672-80202694 ACAGAGGAATAGACTGAGGAGGG + Intergenic
1130772195 15:86935753-86935775 AAAGAGAGCCGCACTGAGGCTGG + Intronic
1131898578 15:97062110-97062132 AAAGAGAAAGTGACTGAGCATGG + Intergenic
1133398854 16:5470095-5470117 AAAGGGAAACAGACTCAGCAGGG + Intergenic
1133735370 16:8610994-8611016 CCACAGAATCAGACTGAGGATGG + Intergenic
1133848171 16:9476564-9476586 AAAGAGAGTCAAACTGATGAAGG + Intergenic
1134316808 16:13126536-13126558 AGAGAGAAAGAGACTGAGGGAGG + Intronic
1134868828 16:17633098-17633120 AAAAGGAAGCAGACAGAGGACGG + Intergenic
1136382503 16:29901994-29902016 AATGAGAACCAGACAGCAGACGG - Intronic
1139075016 16:63435050-63435072 AAAGAGAAAGAGACAAAGGATGG + Intergenic
1139132668 16:64164902-64164924 AAAGAGAGCCTGACTGAACAAGG - Intergenic
1139194650 16:64905098-64905120 CAAGAGAAACACACTGAGGGTGG + Intergenic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1139481361 16:67232531-67232553 AAAAAAAAAAAGACTGAGGAAGG + Intronic
1140016653 16:71193452-71193474 AAGGAGAACCAGACAGAATAGGG + Intronic
1140747478 16:77993911-77993933 AAACAGACCCAGACTTGGGAGGG + Intergenic
1140757075 16:78077135-78077157 AAAAAGAACTAGATTGAGCATGG - Intergenic
1141113718 16:81290952-81290974 AAAGAGAAAGAGACAGAGGAAGG - Exonic
1141171755 16:81696130-81696152 ACAGAGAACCAAACAGAGAACGG + Intronic
1141794278 16:86259462-86259484 AAAGAGTACCAGAATTGGGATGG - Intergenic
1141858133 16:86698553-86698575 AAAGAGACCAAGTCTTAGGAAGG + Intergenic
1142602446 17:1060700-1060722 CAAGAGAACAAGGCTGAGCACGG + Intronic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1143830798 17:9648836-9648858 AAAGAGAAACAGAAAGAGAAAGG - Intronic
1145376060 17:22350055-22350077 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1146287099 17:31581408-31581430 GGTGAGAGCCAGACTGAGGAGGG - Intergenic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1147426030 17:40346335-40346357 AAAATGAACCAGACTGGAGAGGG - Intronic
1148132157 17:45268598-45268620 AAAGAGAACCCGACACAGAATGG - Intronic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148481685 17:47963740-47963762 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149165666 17:53749212-53749234 AAAGAGAAATAAACTGAGCAAGG + Intergenic
1149367259 17:55958311-55958333 AAAGAAAAAGAGACTGATGATGG + Intergenic
1149719123 17:58825660-58825682 CTAGAGAATCAGACTGAGGCTGG - Intronic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1151536570 17:74742228-74742250 AAAGAGAAAAAGGCAGAGGATGG - Intronic
1151543171 17:74775861-74775883 AAAGAGAACCAGGCTGGTTAAGG + Intronic
1151557380 17:74853337-74853359 AAAGAGAGACAGACAGAGGAGGG + Intronic
1151602742 17:75116329-75116351 AAAGAGTACCAGACCTAGGCCGG + Intronic
1151652817 17:75480707-75480729 AATGAGGACCACACTCAGGAAGG - Intronic
1151671570 17:75574152-75574174 AGAGAGAGCCAGGCCGAGGAGGG + Intronic
1152003242 17:77660460-77660482 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1152276156 17:79358749-79358771 AGAGAGAACCAGGCCGAGCACGG - Intronic
1152283054 17:79396643-79396665 AAAGGGACCCAGACTCAGGAGGG + Intronic
1152456044 17:80416739-80416761 AAAGAGAGACAGAGAGAGGAAGG - Intronic
1152937826 17:83150829-83150851 AAAGAAAGCCAGACTGAGGATGG - Intergenic
1153448213 18:5197091-5197113 AAAGACAGGCAGACGGAGGATGG + Exonic
1153763850 18:8356501-8356523 AAACAGAAACACACTCAGGATGG + Intronic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155134634 18:22977862-22977884 AGAGAAAACAAGACTCAGGAGGG - Intronic
1155706712 18:28824362-28824384 ACAGAGGAACAGACTCAGGATGG - Intergenic
1156504293 18:37579382-37579404 AAAGAGAGACAGACTGATGGAGG - Intergenic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156777704 18:40813423-40813445 AAAGAGAAACAGACAGAGACAGG - Intergenic
1157082055 18:44535993-44536015 AAAGAGAACATGCCTTAGGAAGG - Intergenic
1157248071 18:46071398-46071420 GAAGAGGACTAGACAGAGGAGGG + Intronic
1158401446 18:57125141-57125163 AGAGAGCACTGGACTGAGGATGG + Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160521128 18:79508758-79508780 ACAGAGAAACAGAGCGAGGAAGG - Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162874826 19:13613286-13613308 AGAGAGAACAAGAGAGAGGAGGG - Intronic
1162877798 19:13633798-13633820 AAAGAGAGAGAGACAGAGGAAGG - Intergenic
1162954977 19:14092451-14092473 AAAGAGAAGCAGACTGACTTTGG - Exonic
1163082556 19:14954337-14954359 AAAGAGCCCAGGACTGAGGATGG + Intronic
1163164646 19:15487549-15487571 AAAAAGAGCCAGGCTGAGGCAGG - Intronic
1163776981 19:19224627-19224649 AAAGAGGATCAGAGAGAGGAAGG - Intronic
1165060019 19:33200625-33200647 AAAGGGAACCAGGCTGGGGCCGG + Intronic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1165620879 19:37246472-37246494 AAAGAATACCAGTCTGAGGCTGG + Exonic
1165998731 19:39864514-39864536 AACTAGAACCAGGCTGAGGGAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166234436 19:41445598-41445620 AATGAGGACCAGGCTGGGGATGG - Intergenic
1166309527 19:41955103-41955125 AAAGAGAAACACACTTGGGAGGG - Intergenic
1167348953 19:48963227-48963249 AAAGAGACCCAGAGAGAGGGGGG - Intergenic
1167459153 19:49615259-49615281 ACAGAGAACCAGACGCATGAGGG + Intronic
1167690232 19:50980568-50980590 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167690267 19:50980710-50980732 ACAGAGACCCAGAGAGAGGAGGG + Intronic
1167752699 19:51390424-51390446 ACAGAGACCCAGAGAGAGGAGGG - Intronic
1168592427 19:57648461-57648483 AAAGAAAGACAGACTGAGGGTGG + Intergenic
925804179 2:7632024-7632046 AAAGTGACCCTGGCTGAGGATGG - Intergenic
927119873 2:19948567-19948589 AAAGAGAAACAGACAGCAGAAGG + Intronic
927515141 2:23667876-23667898 AAAGAGGAACAGAGGGAGGACGG - Intronic
929379966 2:41337928-41337950 AAAGAGAGTCAGAATAAGGAAGG + Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
930417797 2:51110936-51110958 AAAGAAGACCAGAGAGAGGAAGG - Intergenic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932598691 2:73110100-73110122 AGAGAGGACCTGACTGGGGAAGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933233897 2:79842955-79842977 AAAGAGATCCACACAGAGTATGG + Intronic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
935849477 2:107202829-107202851 GAAGAGAACCAGACTAAAAAGGG + Intergenic
936267844 2:111023833-111023855 AAGGACACCCAGACCGAGGAGGG + Intronic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937524328 2:122748529-122748551 AGAGAGAACAAGGCTGAGCAAGG - Intergenic
937617320 2:123941273-123941295 GAAGACAACCAGACAGTGGAAGG + Intergenic
937650751 2:124316272-124316294 AAAGAGAACTAGCCTGGGGTCGG + Intronic
937683565 2:124670172-124670194 AAAGAGAAAGAGAGGGAGGAAGG - Intronic
939249871 2:139669357-139669379 TAAGAGCACCAGTCTGAGGTGGG + Intergenic
939663767 2:144923852-144923874 AAAGAGAACTAGAATTAGAAGGG + Intergenic
941222136 2:162795782-162795804 AAATAGAACCAGTCAGAGCAAGG - Intronic
941638567 2:167962476-167962498 AACGAAAACCAAACTCAGGAGGG - Intronic
941834848 2:170004931-170004953 AAAGAGAACAAGGCTGGGCATGG + Intronic
941999714 2:171633794-171633816 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
942248895 2:174031411-174031433 AAAAAGAACAAAACAGAGGAGGG + Intergenic
944068337 2:195642974-195642996 AAAGGGAACAAGACTGAAGGTGG + Intronic
944274431 2:197819351-197819373 AAAGTGAGCAAGACTGAGTAAGG + Intronic
944472809 2:200072978-200073000 AAAGAGACACAGACAGAAGAAGG - Intergenic
945321629 2:208430859-208430881 AAAGAGAGCCAGACAGAGGCCGG - Intronic
945901060 2:215538098-215538120 AAAGAAAGACAGACAGAGGAGGG - Intergenic
946758265 2:222968078-222968100 AAAGAGAACCCAGCTGAAGATGG + Intergenic
946888289 2:224246634-224246656 GAAGAAAACCAGATTTAGGAAGG - Intergenic
947197918 2:227587154-227587176 AAAGAGAACCAGGGCGAGGTTGG + Intergenic
947658889 2:231852059-231852081 AAAGAGAAAGAGAAAGAGGAAGG - Intergenic
947691620 2:232142198-232142220 AAAGCAAATCAGGCTGAGGAGGG + Intronic
948069716 2:235110642-235110664 AAAGAGAACAAAAAGGAGGAAGG + Intergenic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948433709 2:237937620-237937642 AAATAAAACCAGAAAGAGGAGGG + Intergenic
948624843 2:239262600-239262622 AAATGGAGCCAGGCTGAGGATGG - Intronic
948789820 2:240371461-240371483 TGAGGGAACCAGACAGAGGATGG + Intergenic
1168835958 20:877621-877643 ACCAAGAACCAGGCTGAGGAAGG + Intronic
1169155571 20:3327078-3327100 AGAGATGACCAGACTGAGGAAGG + Intronic
1169481368 20:5985018-5985040 AAACAGAACCAAACTGAATAAGG - Intronic
1169512973 20:6284856-6284878 AAAGTCAAACAGAGTGAGGAAGG + Intergenic
1169634770 20:7676969-7676991 AAAGGGAACATGAGTGAGGAGGG + Intergenic
1170464048 20:16606807-16606829 TCAGAGATCCAGACTGAGGGAGG + Intergenic
1170595401 20:17801745-17801767 AAAAAGACCCAGACCCAGGAAGG - Intergenic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1170998539 20:21390999-21391021 AAAGAGATGAAGACTAAGGATGG - Intergenic
1171011977 20:21513832-21513854 AAAGAGAAAGAAACTGGGGATGG + Exonic
1171527038 20:25821876-25821898 AAAGAGAACCAAGGAGAGGATGG + Intronic
1171549789 20:26034008-26034030 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1171950980 20:31421752-31421774 ACAGAGGACCAGACAGAAGAAGG + Intergenic
1172234232 20:33359127-33359149 AAAGAAAACCAGGCAGAAGAAGG + Intronic
1172247846 20:33458175-33458197 AAAGAGAACCAGTGTGAGGGTGG + Intergenic
1174700663 20:52605233-52605255 AAAGAGATCCAGGCTGGGCATGG + Intergenic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174837113 20:53866985-53867007 AAAGAGAACCAGGCTAAGGGTGG + Intergenic
1175650227 20:60715419-60715441 AAAGAGCACTAGCCTGAGGGAGG - Intergenic
1175917918 20:62435886-62435908 AAATGGAACCACACTGAGGCGGG + Intergenic
1175929498 20:62487046-62487068 AAACAGAACTAGGCTTAGGAAGG + Intergenic
1176924128 21:14725962-14725984 AGAGAGAACCAGAGGGAGGGAGG + Intergenic
1177383477 21:20376599-20376621 ACAGAGAACAAGACAGAGAAGGG - Intergenic
1177580193 21:23011951-23011973 AAAGAGAGACAGAGAGAGGAGGG + Intergenic
1177633799 21:23759939-23759961 AAAGAGACTGAGACTTAGGAAGG - Intergenic
1177657810 21:24041861-24041883 AAAGAGATCAAGAGAGAGGATGG - Intergenic
1177836382 21:26190095-26190117 AAAGAGAAGCAAGCAGAGGAGGG + Intergenic
1178067486 21:28921716-28921738 AAAGAGAACCAGTCTGAGACAGG + Intergenic
1178092870 21:29183067-29183089 AAAGAGAAGCACACTTAAGAAGG + Intergenic
1179244793 21:39623282-39623304 AAAGAGAAACAGAGGAAGGAAGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1182332527 22:29561206-29561228 AAAGAGAACCAAAGGGATGATGG + Intronic
1182497376 22:30719188-30719210 AAAGAGAAGGGGAGTGAGGAGGG - Intronic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1182910190 22:33977587-33977609 AAAGTGAAGCAGAATGAAGATGG - Intergenic
1183533731 22:38381707-38381729 AAAGAGAAACAGACTACAGAGGG - Intronic
1184484356 22:44767057-44767079 ACAGCAAACCAGCCTGAGGATGG - Intronic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1185127406 22:49018781-49018803 AAAGCCAACCCCACTGAGGACGG - Intergenic
949401064 3:3665849-3665871 AAAGAGAGAAAGACAGAGGAAGG + Intergenic
950152766 3:10700822-10700844 TCAGAGAACCAGACTGAGGGAGG + Intronic
950795946 3:15510801-15510823 AAAGAGACCAAGAGAGAGGAAGG + Intronic
950904913 3:16529464-16529486 AAACAGAATCAGACAGAAGAGGG - Intergenic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
951201774 3:19883289-19883311 AAAGAAAACCAGGCTGGGCATGG - Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
951745736 3:25975203-25975225 GAAAAGGACCAGACTGAGTAAGG - Intergenic
952637104 3:35545702-35545724 AAAGGCAAACAGACTGAAGATGG + Intergenic
952973963 3:38678499-38678521 AAAGAGAATCAGAATGGGAAGGG + Intergenic
953211767 3:40881647-40881669 AAAAAGAACTAGACTGGGCACGG - Intergenic
953672602 3:44975732-44975754 AGAGAGACCCCGACTAAGGAGGG - Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954245370 3:49327239-49327261 AAAGAGAACCAGAAACAGGCTGG + Intronic
954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG + Intergenic
954756608 3:52843803-52843825 AAAGAGAAGCAGACTCAGTGAGG + Intronic
955444945 3:58999863-58999885 AAAAAGAACCTGACAGAGCACGG + Intronic
957379941 3:79414217-79414239 AAAGAGAAAGAGAAAGAGGAGGG - Intronic
957957059 3:87201295-87201317 AAAGAGAACGTGAATGATGAGGG - Intergenic
959060367 3:101611137-101611159 AAAGATAACCAGACCTTGGAGGG - Intergenic
959123226 3:102257831-102257853 AACGTGCACAAGACTGAGGAAGG - Intronic
960814281 3:121657455-121657477 ATAAAGACCCAGACTGAAGAAGG - Intronic
961491938 3:127262445-127262467 AAGGCCACCCAGACTGAGGAGGG - Intergenic
962221314 3:133566663-133566685 AAATAGAACTGGACTGAGGGTGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962849952 3:139300975-139300997 AAAGTGAACCAGGTTGGGGAGGG + Intronic
964484246 3:157171277-157171299 AAAGAGAACCAGCTGGAGAATGG + Intergenic
965785039 3:172326725-172326747 AACGAGAAAAAGACTGGGGAGGG - Intronic
965847389 3:172980047-172980069 ATAGAGAACCAGACAAAGGAAGG - Intronic
966679420 3:182625690-182625712 AAAGGGCAACATACTGAGGAAGG + Intergenic
966738008 3:183205418-183205440 AAATAGAATTAGACTGGGGATGG + Intronic
967793636 3:193575057-193575079 AAAGTGAACTAGTCTGAGAATGG + Intronic
967818589 3:193819296-193819318 AAAGAGAAGCCGAGTGAGGCTGG - Intergenic
968289718 3:197529100-197529122 CAAGAGAACCCGTCTGGGGAGGG - Intronic
968391398 4:195982-196004 AAAGAGAAGCAGAGAGAGAAAGG - Intergenic
969216866 4:5730131-5730153 ACAGATAAACAGACTGAGGCAGG - Intronic
969644892 4:8422133-8422155 AAAGAGAAACAGAGAGAGAAAGG + Intronic
969690226 4:8700051-8700073 AATGCCAACCAGACTCAGGATGG - Intergenic
969963345 4:10969541-10969563 AAAGAGAAGGAGAGAGAGGAAGG - Intergenic
970702905 4:18764067-18764089 AAAGAAAACCAGGCTGGGCACGG + Intergenic
970947551 4:21712932-21712954 AAAGAGAAGCAGACACAGGGAGG - Intronic
971034173 4:22675142-22675164 AAAGAGAAAGAGAGGGAGGAAGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972182185 4:36481339-36481361 AAAGAGAAACAGACAGAGATGGG - Intergenic
972578722 4:40375954-40375976 AAAGAAAACCAGAGAGAGGAAGG - Intergenic
973936895 4:55855220-55855242 AAAGAGAACCAGATTTTGTAGGG + Intronic
974492626 4:62586930-62586952 AAAGAAAGCCAGTCTGAGCAAGG - Intergenic
974608340 4:64183026-64183048 AGAGAGAAAGATACTGAGGAGGG + Intergenic
975112312 4:70641828-70641850 AGAGAGAACCAGAAAGAGTATGG + Intronic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
977716659 4:100190567-100190589 AAAGGGGACCAGACTCTGGAGGG - Intronic
978696201 4:111583594-111583616 AGAGAGAAAGAGAGTGAGGAGGG + Intergenic
979213544 4:118135246-118135268 GAAGAGAAGCAGGCTTAGGAAGG + Intronic
979559753 4:122088767-122088789 AAAGAGAACCAGTTTTTGGAGGG - Intergenic
980046733 4:127997541-127997563 GAAGAGAGGCAGACTGAAGAGGG - Intronic
980094249 4:128473188-128473210 GAAGAGAAACAGATTGAAGATGG + Intergenic
981530415 4:145747717-145747739 AAAGAGAAAGAGAGAGAGGAAGG - Intronic
982205180 4:152992407-152992429 AAATGGAACCAGGCAGAGGATGG + Intergenic
984662666 4:182390054-182390076 ACAGAAAACCAAACTGAGGGAGG - Intronic
984767070 4:183407947-183407969 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
985063203 4:186098181-186098203 AAAGAGAAATAGACGGAGCAGGG - Intergenic
986143449 5:5053117-5053139 AAAGAAAAACAGACAGAGGAAGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987517997 5:18939685-18939707 AAAGAGAACAAAATTGTGGATGG + Intergenic
987910175 5:24132529-24132551 AAAGAGAACCAGAAAGAATATGG + Intronic
988609810 5:32713350-32713372 AAAGAGCTCGAGGCTGAGGATGG + Intronic
989405798 5:41059111-41059133 AAAGAGAAACAGAGTCAGGTGGG - Intronic
989429746 5:41338939-41338961 TAAAAGAACCAGAATGAGGGCGG - Intronic
991500110 5:67268454-67268476 AGAGAGAACAGGACTGGGGAAGG - Intergenic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994455712 5:100004786-100004808 GGAGAGAACCAGAGTGAGGGAGG - Intergenic
994668186 5:102732795-102732817 AAAGAAAACCAGACCCAGGAAGG + Intergenic
994799189 5:104349489-104349511 AAAGAGAACCACACGGAAGAAGG + Intergenic
995087100 5:108124294-108124316 AAAAAGAACCAGAGTGATGCAGG + Intronic
995899835 5:117052701-117052723 AAAGAGGACCAAAGTGAGGTGGG - Intergenic
997368578 5:133341563-133341585 AAAGAGCACCAGACAGAGAGGGG - Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998408698 5:141890639-141890661 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
998503408 5:142652992-142653014 GAAGAAAACGAGACAGAGGAAGG - Intronic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999550351 5:152679680-152679702 TAAGAGAAAAAGACTGAAGAAGG - Intergenic
1000362293 5:160458969-160458991 ACAGAGACCCACACAGAGGAAGG - Intergenic
1001332051 5:170769329-170769351 GAAGAGAAAGAGGCTGAGGAAGG + Intronic
1001744959 5:174085393-174085415 AAAGAGAACCAGTGTGAGGTGGG - Intronic
1001763686 5:174227845-174227867 AAAGAGACCCTGCCGGAGGAAGG + Intronic
1002972160 6:2034929-2034951 GAAGAAACCCAGCCTGAGGATGG + Intronic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003637321 6:7844683-7844705 CACGTGAACCAGCCTGAGGAGGG + Intronic
1004184370 6:13409350-13409372 AGAGAGAAAGAGACAGAGGAAGG + Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1007779728 6:44246076-44246098 AAAGCGAACCAGCTTGAGAAAGG + Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008012909 6:46488072-46488094 AAAGAGAACTGGACTGAGTCAGG - Intronic
1008034318 6:46730141-46730163 AAAAATAACCAGAATGATGAGGG + Intronic
1010510213 6:76709000-76709022 AATGGGAACCAGGCAGAGGAAGG + Intergenic
1011069933 6:83369638-83369660 AAAGAGAGACAGAGAGAGGAAGG + Intronic
1011336356 6:86265689-86265711 GAAGTGAAACAGACTGGGGAAGG - Intergenic
1011472729 6:87723953-87723975 AAAGAGACCCAGAATGGGGCTGG - Intergenic
1011548324 6:88504594-88504616 AAAGAGAAGCTGACAGAGCAGGG - Intergenic
1011563998 6:88655547-88655569 GGACAGAACCAGACTGAGGCAGG + Intronic
1011650524 6:89502353-89502375 AAAGAGAAATAGACTGGGCATGG + Intronic
1011689660 6:89854867-89854889 GAAGAGATCCTGACTGAAGAAGG + Exonic
1011902389 6:92314925-92314947 AGAGAGAAAGAGAGTGAGGAGGG - Intergenic
1011976953 6:93313806-93313828 AAATAGGACCAGACTAAGGAAGG + Intronic
1012218474 6:96618394-96618416 AAAGAGAAAGAGTCAGAGGAAGG + Intergenic
1012560574 6:100575477-100575499 AAAGAGAACAGTACTGAGAACGG + Intronic
1013348354 6:109283814-109283836 AAAGAGATCCAGACAGAATAGGG - Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014257920 6:119182677-119182699 AATGAGAACCAGATTGCAGATGG - Intronic
1015219333 6:130786079-130786101 AAAGAAAACTACACTGAGGTGGG - Intergenic
1015619986 6:135121248-135121270 AAAAGGAAACAGACAGAGGAAGG + Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017731175 6:157317494-157317516 AAAGAGAAGAGGTCTGAGGAAGG - Intronic
1017931952 6:158963490-158963512 AAAGAGAAAGAGACTGGGAAGGG - Intergenic
1018074581 6:160200603-160200625 AATGAGAAACAGACCTAGGAAGG - Intronic
1018106605 6:160493345-160493367 AAAGAGAGCTAGACAGATGAAGG - Intergenic
1018654924 6:166025831-166025853 ACAGAGAACTAGGATGAGGATGG - Intergenic
1018711500 6:166500958-166500980 AAAGAGACCCAGCCTGCCGACGG + Intronic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019525979 7:1480754-1480776 ACAGAGACCCAGCCTGGGGAGGG - Intronic
1019525992 7:1480788-1480810 ACAGAGACCCAGCCTGGGGAGGG - Intronic
1019820995 7:3242592-3242614 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1021061211 7:16115139-16115161 ATAAAGAACCAAACTGAAGAGGG + Intronic
1021480116 7:21106454-21106476 AAAGAGAACCCGGGGGAGGAAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1023033773 7:36112692-36112714 GGAGAGAACCAGAGTGAGTAAGG + Intergenic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1024633961 7:51271637-51271659 AAACTGAAAAAGACTGAGGAGGG + Intronic
1024823333 7:53360118-53360140 AAAGAGAAATAATCTGAGGAGGG - Intergenic
1026494119 7:70888062-70888084 AAAGAGAAAAAGAGAGAGGAAGG + Intergenic
1028297715 7:89155955-89155977 AAAGAGAGAGAGACAGAGGAGGG - Intronic
1028538868 7:91920551-91920573 AAGGAGAATCAGACTGGGAATGG + Intergenic
1028921562 7:96315542-96315564 AAAGGGGACAGGACTGAGGAAGG + Intronic
1029162394 7:98561948-98561970 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1029427396 7:100504711-100504733 AAACAGACCCAGGCTGAGCATGG + Intergenic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031912468 7:127532667-127532689 CAACAGAACAAGACTAAGGAAGG + Intergenic
1032220343 7:129989662-129989684 AAAGAGAACATGACTGATTAGGG + Intergenic
1033742514 7:144285490-144285512 AGAGGGATCCAGGCTGAGGAAGG - Intergenic
1034511208 7:151536248-151536270 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1034511212 7:151536315-151536337 AAAGAGAGACAGAGAGAGGAAGG + Intergenic
1035873256 8:3158553-3158575 AAAGAGACCCTGAGTGATGAGGG - Intronic
1035928939 8:3760115-3760137 AAAGAGTAACAGGCTGAGAAAGG + Intronic
1036612105 8:10359238-10359260 AAAGAGACAAATACTGAGGATGG - Intronic
1037244754 8:16820719-16820741 AAGAAGAACAAGACTAAGGATGG + Intergenic
1038405949 8:27323102-27323124 AAAGAGAACCTGAACCAGGATGG + Intronic
1038601809 8:28951875-28951897 TAAGAAAACCAGGCTGAGCACGG + Intronic
1040507240 8:48059884-48059906 AAAGAGCAACAGAATGGGGATGG - Intronic
1040639086 8:49310822-49310844 AAAGAGAAAAAGAGAGAGGAGGG + Intergenic
1040854889 8:51938429-51938451 AAAGGGAACCATGCTGAGCAGGG - Intergenic
1041235698 8:55799862-55799884 AAAGGAAACCAGCCTGAGCATGG - Intronic
1041269033 8:56092806-56092828 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1042181264 8:66089967-66089989 AAAGACAACAAAACTGGGGAAGG - Intronic
1042287300 8:67127760-67127782 AAAAACAACTATACTGAGGATGG - Intronic
1042825193 8:72972682-72972704 AAAGACAACCAGGCTGAGTGAGG + Intergenic
1043973798 8:86563102-86563124 AAACAGAACAAGAGTGAGCAAGG + Intronic
1044319486 8:90786455-90786477 AAAGAGAACAAGAATGGGAAGGG + Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1047422302 8:124717199-124717221 AAACAGCACCAGACTGGGCATGG + Intronic
1047723985 8:127668825-127668847 TAAGAGAACAAGACAGAGGCAGG + Intergenic
1048013486 8:130477417-130477439 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1048540930 8:135341771-135341793 AGAGAGAGCAGGACTGAGGAGGG + Intergenic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1050197597 9:3104054-3104076 AAAGAGAAACAAACTATGGAGGG + Intergenic
1050767815 9:9157584-9157606 AAAGAGACCAAAAATGAGGAAGG + Intronic
1051804522 9:20977169-20977191 ACAGAGAACCAGAAAGATGATGG - Intronic
1052109216 9:24559864-24559886 AAAGAGGACCAGGTTTAGGAAGG + Intergenic
1052327287 9:27228833-27228855 AATGAGATTCAGACAGAGGAAGG + Intronic
1053587648 9:39477249-39477271 AAAGATAAACATACTGAGGCCGG - Intergenic
1053794970 9:41717965-41717987 AAAGAGAACCAAGGAGAGGATGG + Intergenic
1054150204 9:61596859-61596881 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1054183378 9:61930028-61930050 AAAGAGAACCAAGGAGAGGATGG + Intergenic
1054469974 9:65527963-65527985 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1054578651 9:66887990-66888012 AAAGATAAACATACTGAGGCCGG + Intronic
1054655128 9:67658446-67658468 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1055148680 9:72967700-72967722 AAAGAAATCCAGGCTGAGGCAGG - Intronic
1056041345 9:82670476-82670498 AGAGAGAAAGAGACAGAGGAAGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057806400 9:98222927-98222949 AGAGAGAACCAGAGAAAGGATGG - Intronic
1058026895 9:100150917-100150939 TAAGAGAACCAGAGAGGGGATGG + Intronic
1058478018 9:105360565-105360587 TCAAAGAACCAGACTGAAGAGGG - Intronic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059022280 9:110589819-110589841 AAAGACAACCACACTTAGGGGGG - Intergenic
1059256369 9:112934869-112934891 AAAGAGAAACAGTCCCAGGAAGG + Intergenic
1060563461 9:124567883-124567905 AAAGAGAAACAGGCTGGGCACGG + Intronic
1060592741 9:124829202-124829224 AAAGAGAAAGAGAGAGAGGAAGG - Intergenic
1061485551 9:130918838-130918860 AGAGAGAAACAGACTCAGAAAGG - Intronic
1186852122 X:13590926-13590948 ATTGAGAACCAGACTGACGTGGG + Intronic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187786583 X:22894955-22894977 AGAGAGAAAAAGGCTGAGGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1189994157 X:46623222-46623244 GAACAGCACCGGACTGAGGAAGG + Intronic
1190439575 X:50463604-50463626 AGAGAGAAACAGAGAGAGGAAGG - Intronic
1192306370 X:69964351-69964373 TAAGAAAACTATACTGAGGAAGG + Intronic
1193212296 X:78821582-78821604 AAATAGAAGCAGCCTGAGGTGGG + Intergenic
1193301924 X:79899452-79899474 AAAGAGAGAGAGACTGAGGCAGG + Intergenic
1195392237 X:104374831-104374853 AAAAAGAACCAGGCTGGGTATGG + Intergenic
1195412629 X:104584559-104584581 AAAGAATACCAGACCCAGGAGGG + Intronic
1195462654 X:105145025-105145047 AAAGAGGGCCTGGCTGAGGACGG + Intronic
1196039828 X:111190194-111190216 AAACACAAGCAGAGTGAGGAGGG + Intronic
1197120588 X:122886307-122886329 AAAATGAACCATACAGAGGATGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198295568 X:135283338-135283360 AAAGAAAACAAGAATGAGAATGG + Intronic
1201225446 Y:11814088-11814110 AGAGAGAAAAAGACTGTGGAAGG - Intergenic
1202593715 Y:26514311-26514333 AAAGAGAAACAGACTACAGAAGG + Intergenic