ID: 962703628

View in Genome Browser
Species Human (GRCh38)
Location 3:138022678-138022700
Sequence GGCAAGGCCCCTAGTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962703628_962703632 -5 Left 962703628 3:138022678-138022700 CCAACCACACTAGGGGCCTTGCC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 962703632 3:138022696-138022718 TTGCCTTCTGGAACACATGAAGG 0: 1
1: 0
2: 1
3: 9
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962703628 Original CRISPR GGCAAGGCCCCTAGTGTGGT TGG (reversed) Intronic
902443145 1:16444322-16444344 GCCGAGACCCCTAGTGGGGTCGG + Intronic
902816416 1:18919027-18919049 GGCATGGCTCCTGGTGTGGAGGG - Intronic
903236970 1:21956529-21956551 GGAAGGGCCCCTAGTGTTCTTGG - Intergenic
904307820 1:29601604-29601626 TGCAAGGCCAGTGGTGTGGTGGG - Intergenic
906660892 1:47580809-47580831 GGGCAGGCCCCTCATGTGGTGGG + Intergenic
907537004 1:55171935-55171957 GCCAATGCCCCAAGTGTGCTAGG + Intronic
910208648 1:84772713-84772735 GGCAAAGGCCTTAGTGCGGTGGG + Intergenic
911084134 1:93962561-93962583 TGCAATGCCCCTGGTGTGGAAGG + Intergenic
915585190 1:156840544-156840566 GGCAGGGCCTCTAGGGTGGGCGG + Exonic
915801266 1:158795535-158795557 TGCAAGGTCCCTTGTGAGGTAGG + Intergenic
1067743355 10:48913725-48913747 TTCAGGGCCCCCAGTGTGGTGGG + Exonic
1069917853 10:71798302-71798324 GGGAAGGACACTAGTGTGGCTGG - Intronic
1075545355 10:123350972-123350994 TGGAAGGCCCCTCGTGGGGTTGG + Intergenic
1081282857 11:41231601-41231623 GCCAGGGCCCCTTGTGGGGTGGG + Intronic
1082983449 11:59145069-59145091 TGCAAGTCCCCTTGTGTGCTGGG + Exonic
1083619270 11:64040908-64040930 GGCCAGGCCCCAGGTGTGGCAGG + Intronic
1083770732 11:64865448-64865470 AGCAAGGCCCCTACCTTGGTGGG - Intronic
1084028946 11:66469607-66469629 GGCAAGGCCACTAATGTGGGAGG + Intronic
1086074854 11:82839722-82839744 GGGAAGGAGCCTGGTGTGGTGGG - Intronic
1086906007 11:92418653-92418675 GGCATGGTCCCCAGAGTGGTAGG - Intronic
1089190316 11:116648827-116648849 GGCCAGGTCCCTAGTGTGGATGG + Intergenic
1089702758 11:120255292-120255314 GGCAAGCCCCCTACTGGGGCAGG - Intronic
1091556232 12:1575626-1575648 GGCAAGGATCCCAGTGTGCTTGG - Intronic
1096727765 12:53578835-53578857 GGCAAGGATCCCAGTGTGCTTGG - Intronic
1101643062 12:106602361-106602383 GGTAAGGCACTTAGTGTGTTTGG - Intronic
1105654340 13:22419781-22419803 GGAAAGGCCCAGAGTTTGGTAGG + Intergenic
1105689483 13:22821686-22821708 GGCAAGGCCCTAAGTGTGTGTGG - Intergenic
1107556136 13:41518076-41518098 GGGAAGTCCCCTAGTGTGTAGGG + Intergenic
1118046055 14:61972742-61972764 GGCAGGCAGCCTAGTGTGGTGGG + Intergenic
1122256903 14:100485060-100485082 GGCAAGGAGCCTAGTGGGGCTGG - Intronic
1126049621 15:44674184-44674206 GTCAAGGCCCCTGGTATGCTGGG - Exonic
1128611033 15:69074017-69074039 GGCATTGCCCCTAGGGTGCTCGG + Intergenic
1128789505 15:70422874-70422896 GGCAAGACAATTAGTGTGGTAGG - Intergenic
1129139418 15:73583771-73583793 GGAAAGGCAGCTAGTGTGATAGG - Intronic
1132425088 15:101709407-101709429 GGCAAGGAAGCTAGTGTGGCAGG - Intronic
1133141405 16:3747353-3747375 TACAAGGCCCCTAGAGTGGGTGG - Intronic
1134106208 16:11487277-11487299 GGCACGGCCCATGGTGTGGATGG + Exonic
1136786462 16:32938135-32938157 GGCAAGGCCACAGGTGTCGTGGG - Intergenic
1137883375 16:52076361-52076383 AGCAAAGCCCCTAGTCAGGTCGG - Intronic
1138101124 16:54253149-54253171 GGGAGCACCCCTAGTGTGGTGGG - Intronic
1138597310 16:58035896-58035918 GGCCAGGTCCCTGGTGTGGCTGG - Intronic
1139549142 16:67663881-67663903 GGCAGGGCTCCTGGTGTGGGGGG - Intronic
1143116919 17:4586166-4586188 GCGAATGCCCCTAGTGTGCTGGG + Intronic
1143621774 17:8084895-8084917 GCCAGAGCCCCTTGTGTGGTGGG - Intronic
1152612908 17:81324298-81324320 GGCAGGGACCCGAGTGTGGGAGG - Intronic
1156353611 18:36322424-36322446 GGTAAGGCCCCTTCTGTTGTGGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1161614089 19:5260519-5260541 GGCAAGACCCCCAGAGTGCTGGG - Intronic
1161987291 19:7663140-7663162 AGGAAGGCCCCTAGTGAGGGGGG - Intergenic
1165597764 19:37024930-37024952 GGGAAGGCCTTTAGTGTGTTTGG - Intronic
1165673429 19:37699418-37699440 GGCAAGGCCTTTAGTGTGTATGG - Exonic
935416060 2:102820699-102820721 GGCAAGGCAGCTTGTGTGGCTGG + Intronic
936946144 2:117932663-117932685 GCCAGGGCTCCAAGTGTGGTAGG - Intronic
938066452 2:128284302-128284324 GAGAAGGCCCCTAGGGTGGGGGG - Intronic
938140096 2:128787899-128787921 CGCAAAGCCCCTCCTGTGGTTGG - Intergenic
940016435 2:149111079-149111101 GGCAAGGAGGCTAGTGTGTTGGG + Intronic
941783547 2:169475127-169475149 GCCAAGGGGCCTACTGTGGTAGG - Intergenic
942659838 2:178252900-178252922 GTCATGGCTCCTGGTGTGGTTGG + Intronic
948150734 2:235742687-235742709 GGCAAGGTCCCTCCTGTGGCTGG + Intronic
1171446031 20:25205575-25205597 GGGAAGCCCCCGAGTGTGGTGGG + Intronic
1173139331 20:40468462-40468484 GGCAAGGTCCCTACTGTCCTGGG - Intergenic
1173198016 20:40931967-40931989 GACAAGGCCCCTAGAGTGGGTGG + Intergenic
1175377117 20:58535656-58535678 GGGCAGGGTCCTAGTGTGGTGGG + Intergenic
1180723250 22:17925132-17925154 TGCTCGGCACCTAGTGTGGTTGG - Intronic
1181422310 22:22810557-22810579 GGCGAGGCCCCGAGAGTGGCAGG - Intronic
1182757628 22:32692543-32692565 GACAAGGCCTCCAGGGTGGTTGG - Intronic
1184141098 22:42577775-42577797 GGCACTGTCCCCAGTGTGGTAGG - Intergenic
1184333625 22:43840852-43840874 GGCCAGGCCCCTCGTGCCGTGGG + Intronic
950239203 3:11352870-11352892 GGCAAGGACCAGAGAGTGGTGGG + Intronic
952331227 3:32366165-32366187 GGCAGAGCCCCCAGTGTGGGGGG + Intronic
953903200 3:46854825-46854847 GGCAGGGCCCCTAGGTTGGCTGG - Intergenic
959049875 3:101514256-101514278 GGTAAGGCCCCAGGTGTTGTGGG + Intergenic
959449642 3:106482994-106483016 GGCAAGTCAACAAGTGTGGTAGG + Intergenic
959996884 3:112690126-112690148 GGCAAGGCCGCTACTGAGCTGGG - Intergenic
962520606 3:136195283-136195305 GCCAAGGCCCCATGTGTGGGAGG - Exonic
962703628 3:138022678-138022700 GGCAAGGCCCCTAGTGTGGTTGG - Intronic
969044619 4:4327835-4327857 GGGAAGGTCCCCAGTGTGCTTGG - Intergenic
969080660 4:4615410-4615432 GGGAAGGCCCCTCGTGTGGAAGG + Intergenic
969676361 4:8616524-8616546 GGGTAGGCCCCCAGTGTGGCTGG + Intronic
981619077 4:146673420-146673442 GCCAAGGCACCAAGTGTGGTGGG + Intergenic
984917090 4:184734356-184734378 GGGACGGCCCCTTGTGGGGTGGG + Intergenic
988782258 5:34533021-34533043 GGCCAGCCCCCTAGTTTGGAAGG + Intergenic
997538050 5:134638037-134638059 GTCAAGGCCCCCAGTGGGCTAGG - Intronic
1002870671 6:1164867-1164889 AACAAGGCCCTTAGTGTGGAGGG + Intergenic
1006563880 6:34937491-34937513 GGTAAGGCCCTTACTGTGGAAGG + Intronic
1007248001 6:40476168-40476190 GGCATGGCCCTGAGTGTGGATGG - Intronic
1018171914 6:161150500-161150522 GGAAAGGCCCTTGGTCTGGTTGG + Intronic
1019259845 7:75623-75645 GGCAGGACCCCTGATGTGGTGGG + Intergenic
1021414905 7:20372456-20372478 GGCAAGCAACTTAGTGTGGTAGG + Intronic
1021569495 7:22050117-22050139 GGCAGCTCCACTAGTGTGGTGGG + Intergenic
1023848893 7:44139707-44139729 GGTGAGGCCCCTAGTGAGGGGGG - Intronic
1023857737 7:44194992-44195014 GGCAAGGGCCATTGTGTGGCTGG + Intronic
1035892371 8:3359075-3359097 GGCAAGAAGCCTAGGGTGGTCGG - Intronic
1038779580 8:30558440-30558462 GGCCAGGCCACTGGTGTGGATGG + Intronic
1045462784 8:102440801-102440823 GGAAAGGTGCCTATTGTGGTGGG - Intergenic
1049674894 8:143885040-143885062 GGCTAGGCCCCAAGTCTGGGGGG - Intergenic
1056900677 9:90596721-90596743 GGCAAGCCCCCTTCTGTGGATGG + Intergenic
1061419640 9:130466314-130466336 GGCCTGGCCCCACGTGTGGTCGG - Intronic
1061703658 9:132435578-132435600 GGCTTGGCCCCTGGGGTGGTTGG + Intronic
1194208545 X:91040286-91040308 CGCAAGGCCCCTGGTGGTGTAGG + Intergenic