ID: 962706905

View in Genome Browser
Species Human (GRCh38)
Location 3:138052371-138052393
Sequence CCTTCCACACGGTGGCACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962706905_962706912 20 Left 962706905 3:138052371-138052393 CCACAGTGCCACCGTGTGGAAGG No data
Right 962706912 3:138052414-138052436 ACAAAATAAAACCGAAGCAGTGG No data
962706905_962706910 -9 Left 962706905 3:138052371-138052393 CCACAGTGCCACCGTGTGGAAGG No data
Right 962706910 3:138052385-138052407 TGTGGAAGGCACCTGTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962706905 Original CRISPR CCTTCCACACGGTGGCACTG TGG (reversed) Intergenic
No off target data available for this crispr