ID: 962708566

View in Genome Browser
Species Human (GRCh38)
Location 3:138067525-138067547
Sequence GCTCACCTGAGCCCTGGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 476}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962708557_962708566 3 Left 962708557 3:138067499-138067521 CCCAGCCCACTCACCCAAAGGTG 0: 1
1: 0
2: 1
3: 55
4: 1351
Right 962708566 3:138067525-138067547 GCTCACCTGAGCCCTGGCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 476
962708555_962708566 11 Left 962708555 3:138067491-138067513 CCGGTGGTCCCAGCCCACTCACC 0: 1
1: 0
2: 2
3: 35
4: 348
Right 962708566 3:138067525-138067547 GCTCACCTGAGCCCTGGCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 476
962708558_962708566 2 Left 962708558 3:138067500-138067522 CCAGCCCACTCACCCAAAGGTGC 0: 1
1: 0
2: 2
3: 12
4: 330
Right 962708566 3:138067525-138067547 GCTCACCTGAGCCCTGGCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 476
962708561_962708566 -10 Left 962708561 3:138067512-138067534 CCCAAAGGTGCCAGCTCACCTGA 0: 1
1: 0
2: 0
3: 14
4: 165
Right 962708566 3:138067525-138067547 GCTCACCTGAGCCCTGGCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 476
962708560_962708566 -3 Left 962708560 3:138067505-138067527 CCACTCACCCAAAGGTGCCAGCT 0: 1
1: 0
2: 0
3: 9
4: 167
Right 962708566 3:138067525-138067547 GCTCACCTGAGCCCTGGCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 476
962708559_962708566 -2 Left 962708559 3:138067504-138067526 CCCACTCACCCAAAGGTGCCAGC 0: 1
1: 0
2: 0
3: 21
4: 128
Right 962708566 3:138067525-138067547 GCTCACCTGAGCCCTGGCCAGGG 0: 1
1: 0
2: 3
3: 46
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962708566 Original CRISPR GCTCACCTGAGCCCTGGCCA GGG Exonic