ID: 962712816

View in Genome Browser
Species Human (GRCh38)
Location 3:138101865-138101887
Sequence CAGCTCGGACAGCTTGGCGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 7, 1: 13, 2: 13, 3: 13, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962712809_962712816 -4 Left 962712809 3:138101846-138101868 CCCGCTGCAGGGCGCCCTCCAGC 0: 2
1: 18
2: 20
3: 69
4: 396
Right 962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG 0: 7
1: 13
2: 13
3: 13
4: 72
962712805_962712816 11 Left 962712805 3:138101831-138101853 CCATGTCCTGCTTGGCCCGCTGC 0: 13
1: 9
2: 21
3: 34
4: 222
Right 962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG 0: 7
1: 13
2: 13
3: 13
4: 72
962712808_962712816 5 Left 962712808 3:138101837-138101859 CCTGCTTGGCCCGCTGCAGGGCG 0: 8
1: 13
2: 16
3: 28
4: 136
Right 962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG 0: 7
1: 13
2: 13
3: 13
4: 72
962712810_962712816 -5 Left 962712810 3:138101847-138101869 CCGCTGCAGGGCGCCCTCCAGCT 0: 1
1: 12
2: 15
3: 35
4: 258
Right 962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG 0: 7
1: 13
2: 13
3: 13
4: 72
962712804_962712816 16 Left 962712804 3:138101826-138101848 CCGCTCCATGTCCTGCTTGGCCC 0: 1
1: 7
2: 13
3: 29
4: 316
Right 962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG 0: 7
1: 13
2: 13
3: 13
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962712816 Original CRISPR CAGCTCGGACAGCTTGGCGT TGG Intronic
903364897 1:22800078-22800100 CAGCTCTGACAGCAGGGTGTGGG - Intronic
904878815 1:33678662-33678684 CAGCTCGGTCAGCTTAGAGGGGG - Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
924698057 1:246420336-246420358 CTGCTCCTACAGCTTGGGGTTGG + Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1067853519 10:49770092-49770114 GGGCTGGGACAGCTTGGCTTTGG + Intergenic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1076231571 10:128823769-128823791 CAGCAAGGGCAGCATGGCGTCGG + Intergenic
1077024527 11:433337-433359 CGGCGCGGCCAGCTCGGCGTGGG + Exonic
1077341818 11:2029612-2029634 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1078077246 11:8173263-8173285 GAGCTGGGGCAGCTTGGAGTGGG + Intergenic
1085319784 11:75566891-75566913 GACCTCGGGCAGCTTGCCGTCGG - Exonic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1202824804 11_KI270721v1_random:84801-84823 CAGCTCTGCCTGCTTGGAGTTGG + Intergenic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096532779 12:52252395-52252417 CAGCTCGGCCAGCTTGCAGCGGG + Intronic
1096537935 12:52287236-52287258 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096542534 12:52316027-52316049 CAGCTCGGCCAGCTTGCAGCGGG + Exonic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096574868 12:52546420-52546442 CAGCTCGTCCAGCTTGGCCCGGG + Exonic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1102883998 12:116508270-116508292 GAGCTTGCAGAGCTTGGCGTTGG - Intergenic
1110558296 13:76885288-76885310 CGACTCGGACAGCTTGTCGAAGG + Exonic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1120896190 14:89534563-89534585 CAGCTAGGGCAGTTTGCCGTAGG - Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126097864 15:45101935-45101957 CACCTCGGCCAGCTGGGCCTTGG + Exonic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1136389164 16:29951464-29951486 CAGCTCGGACACAGTGGGGTAGG - Intronic
1137613999 16:49836300-49836322 CAGCTTGGACAGGTTGGAGGTGG - Intronic
1139576644 16:67846556-67846578 CAGCTGGGCCAGCTTGGGGCCGG + Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1141102779 16:81210219-81210241 CAGCCCTGACACCTTGGTGTCGG - Intergenic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1147585437 17:41651632-41651654 GAGCTGGGACAGCTGGGCGAAGG + Intergenic
1147896559 17:43755357-43755379 CAGCTCGGCCTGGTTGGCTTTGG + Exonic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928730352 2:34224740-34224762 GAGCTCGGAGAGTTTGGAGTAGG + Intergenic
931252878 2:60549683-60549705 CAGCTCGGCCAGCTCGGCCGCGG + Intronic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
933971192 2:87471169-87471191 CAGCTGGGACACCTGTGCGTGGG - Intergenic
934926798 2:98387852-98387874 CAGAACGGAGAGCCTGGCGTGGG + Intronic
936322537 2:111479020-111479042 CAGCTGGGACACCTGTGCGTGGG + Intergenic
938378626 2:130824340-130824362 GAGCTGGGACAGCTAGGCGCTGG - Intergenic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
1170817058 20:19722314-19722336 CAGCTGGGCCGGCTTGGCGGAGG - Exonic
1174601914 20:51731837-51731859 CAGCTGTGACAGCATGGGGTGGG - Intronic
1175440811 20:58989895-58989917 CAGCACGGACATCATGGCCTGGG - Exonic
1175869357 20:62200911-62200933 GAGCTGGGACAGATTGGCTTGGG - Exonic
1179572252 21:42284652-42284674 CAGCTCGAAGAGTTTGGCGCTGG - Exonic
950628376 3:14265091-14265113 CAGCTGTGACAGGTTGGCGGGGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
988609626 5:32712315-32712337 CATCTCGCCCATCTTGGCGTAGG - Exonic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1002875396 6:1205061-1205083 CAGCTCCCACAGCCTGGCGAGGG - Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1012661850 6:101908094-101908116 CAGCTCGGACAGAATGATGTAGG - Intronic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1029259101 7:99289336-99289358 TAGCTCTGCCACCTTGGCGTTGG - Intergenic
1029381372 7:100217344-100217366 CAGCTCGTCCAGCCTGGCCTGGG - Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1031899247 7:127392116-127392138 CCGCGGGGACAGCCTGGCGTGGG + Intronic
1033230039 7:139589654-139589676 GAGAGCTGACAGCTTGGCGTGGG + Intronic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1049798343 8:144506532-144506554 CTGCTCGGTGAGCTTGGCCTTGG - Exonic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060864580 9:126985310-126985332 CAGCTCTGCCAGGTTGGCTTTGG - Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1202148652 Y:21825230-21825252 CATCTCTGACAGCCTAGCGTGGG + Intergenic