ID: 962714070

View in Genome Browser
Species Human (GRCh38)
Location 3:138112217-138112239
Sequence ATTTAGTAGCTGAGTGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 538}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714070 Original CRISPR ATTTAGTAGCTGAGTGAGCA GGG (reversed) Intronic
900466886 1:2830103-2830125 AGTTACTTGATGAGTGAGCAGGG - Intergenic
901284181 1:8063501-8063523 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
901760770 1:11469751-11469773 ATTTACTAGCTGTGTGACCTTGG + Intergenic
902041314 1:13494556-13494578 ATTTACCAGCTGTGTGAGCCTGG - Intronic
902603007 1:17552822-17552844 ATTTACTAGCTGTGTGACCTGGG - Intronic
903607709 1:24587068-24587090 ATTTACTAGCTGTGTGACCTTGG - Intronic
904111536 1:28130065-28130087 ACTTAGTAGCTGTGTGACCCTGG - Intergenic
904481735 1:30798124-30798146 ATTTATTAGCTGTGTGACCCTGG + Intergenic
905245405 1:36609875-36609897 AATTATTAGCTGTGTGAGCTTGG - Intergenic
905353824 1:37366950-37366972 ATTTTGTAGTTGAGTGACCGTGG - Intergenic
905530217 1:38672303-38672325 ATTTATTAACTGGGTGAGCTTGG + Intergenic
905581230 1:39083829-39083851 ATTTACTAGCTGTGTGACCCTGG - Intronic
905591608 1:39168650-39168672 ATTTATCAGCTGAGTGACCTGGG + Intronic
905648979 1:39644032-39644054 ACTTAGTAGCTGTGTGATCTTGG - Intergenic
905842855 1:41199573-41199595 ATTTAGAAGTTGAGTGACCATGG - Intronic
906257925 1:44364865-44364887 ACTTATTAGCTGAGTGAACTTGG + Intergenic
906311690 1:44758981-44759003 ACTTACTAGCTGTGTGAGCCTGG - Intronic
906648647 1:47494320-47494342 TTTTACTAGCTGTGTGATCATGG + Intergenic
906822685 1:48945825-48945847 ATTAATTAGCTGTGTGATCATGG + Intronic
906975789 1:50571377-50571399 ATTTAGCAGCTGTGTGACCATGG + Intronic
907384087 1:54114555-54114577 ACTTATTAGCTGAGTGATCCTGG + Intergenic
907667665 1:56447525-56447547 ATTTATTACCTGAGTGATCCTGG - Intergenic
907691317 1:56669524-56669546 AACTAGTAGGTGAGTGACCATGG - Intronic
907723734 1:56999305-56999327 ACTTACTAGCTGTGTGACCATGG - Intronic
907728701 1:57045039-57045061 ATTTACTAGCTGTGTGACCCTGG - Intronic
907813169 1:57892536-57892558 ATTTACCAGCTGAGTGAACCTGG - Intronic
907968197 1:59354434-59354456 ACTTATTAGCTGAGTGACCTTGG - Intronic
908396148 1:63727530-63727552 ACTTAGTAGCTGTGTGACCTTGG + Intergenic
908597113 1:65700122-65700144 ATTTACTAGCTGTGTGATCTTGG - Intergenic
908767113 1:67564206-67564228 ATTTAGTAGCTGTGTGGTCCTGG + Intergenic
909439926 1:75685836-75685858 CTTTATTAGCTGTGTGAGAATGG - Intergenic
909686595 1:78355550-78355572 ATTGAGTAGCTGTGTGACCTTGG - Intronic
910176512 1:84436500-84436522 ATTTACTAGCTGAGTGACCTTGG - Intergenic
910724631 1:90325788-90325810 ATTTAATAGCTGAATGACCTTGG - Intergenic
910767216 1:90793722-90793744 ATTTACTAGCTGTGTGATCTAGG - Intergenic
911131815 1:94396181-94396203 AATTACTAGCTGTGTGAGCTTGG + Intergenic
912477286 1:109947222-109947244 ATTTATTAGCTGTGTGACCTTGG - Intergenic
912884375 1:113454396-113454418 ACTTAGTAGCTGTGTGACCTCGG + Intronic
912949545 1:114111371-114111393 ATTTAGTAGCTGTGTGCCCTTGG - Intronic
913057581 1:115176461-115176483 ATTTACTAGCTGTGTGACCTTGG + Intergenic
913460265 1:119078092-119078114 ACTTACTAGCTGTGTGACCATGG - Intronic
915153624 1:153855971-153855993 ATGTAGGAGCTGACTGGGCACGG - Intronic
915577693 1:156791391-156791413 AGGAAGTAGCTGAGGGAGCAAGG + Intronic
915806907 1:158863637-158863659 TTTTAGTAGATTAGTGAGTAAGG - Intergenic
916987846 1:170210515-170210537 ATTTATTAGCTGTGTAAGCTTGG - Intergenic
917619080 1:176776954-176776976 ATTTATTGGCTGAGTGATCATGG - Intronic
917973757 1:180225574-180225596 ATTTATTAGCTGTGTGACCTTGG + Intergenic
918958021 1:191236195-191236217 ATTTTGTAGTTGAGTGAGTGTGG - Intergenic
919488097 1:198169478-198169500 ATTTAGTGGCAGAGTGAGTCAGG - Intronic
919679774 1:200422817-200422839 ATTTACTAGCTGTGTGAGCTTGG + Intergenic
919827088 1:201510910-201510932 ACTTAGTAGCTTTGTGACCATGG + Intergenic
919880281 1:201896467-201896489 TTTTATTAGCTGTGTGATCATGG + Exonic
920006055 1:202834668-202834690 ATTTACTAGCTGAGTGACTTTGG + Intergenic
920326408 1:205168306-205168328 ATTTACTAGCTGTGTGACCCTGG + Intronic
920768645 1:208858496-208858518 ATTTAATAGCTGTGTGATCTTGG - Intergenic
920835926 1:209510732-209510754 ATTTATTAGCTGGGTGACCTGGG + Intergenic
921326577 1:213990206-213990228 ATCTATTAGCAGAGTGCGCATGG + Intronic
921374828 1:214463039-214463061 ATTTATTAGCTGGGTGACAATGG - Intronic
921545916 1:216475045-216475067 AGTAAGTAGCTGTGTGAGCTTGG - Intergenic
921765135 1:218963194-218963216 TTTTAGTATCTAGGTGAGCATGG + Intergenic
922168292 1:223134040-223134062 GTTTAGTAGGTGTGTGAGCTTGG + Intronic
922213938 1:223505772-223505794 ATTTACTAGCTGTGTGAGGTTGG + Intergenic
922647960 1:227310292-227310314 ATTTAATAGATGCTTGAGCAAGG - Intronic
922992021 1:229922275-229922297 ACTTACTAGCTGAGTGACCGTGG - Intergenic
923539887 1:234880663-234880685 ATTTAGTAGCTGTGTGACTTTGG - Intergenic
924145095 1:241065795-241065817 ATTTATTAACTGAGTGATGATGG + Intronic
924154564 1:241162822-241162844 ATTTATTAGCTGTGTGAACTCGG - Intronic
924459544 1:244246441-244246463 ACTTACTAGCTGAGTGATCTTGG - Intergenic
924656586 1:245978093-245978115 TTGTAGGAGCTGAGTGAACATGG + Intronic
1063110140 10:3028552-3028574 GTTTATTAGCTGGGTGAGCGTGG - Intergenic
1063210394 10:3875596-3875618 ATTTAGTAGCTGTGTGAATTGGG + Intergenic
1064938619 10:20708129-20708151 ATTTAGAAGCAGAGTCAGCTTGG - Intergenic
1065104587 10:22369597-22369619 ATTTAGTTGCTGTGTGACCTCGG + Intronic
1065376548 10:25049063-25049085 ATTTGCTAGCTGAGTGACCAGGG + Intronic
1065612318 10:27484347-27484369 GTTAAGTAGCTGGCTGAGCATGG + Intergenic
1065966951 10:30778484-30778506 ATTTAGTAGTTGAGTGTTCTGGG - Intergenic
1066593717 10:37024846-37024868 ATTTACTAGCTGTGTGACCTGGG + Intergenic
1067759291 10:49031256-49031278 ATTTACTAGCTGTGTGACCTCGG + Intronic
1069322290 10:67187126-67187148 ACTTACTAGCTGAGTGATCTTGG - Intronic
1069910567 10:71756476-71756498 ATTTCCTTGCTGAGTGAGCCAGG - Intronic
1070078510 10:73162318-73162340 ATTTAGCATCTGACTGAACATGG + Intronic
1070127446 10:73633647-73633669 ATTTATTAGCTGTGTAGGCATGG - Intronic
1070444893 10:76487784-76487806 ACTTAGTAGCTGTGTGATCTTGG - Intronic
1070507219 10:77124822-77124844 CTTTATTAGCAGAGTGAGAACGG - Intronic
1070662755 10:78319398-78319420 ATTTACTAGCTGTGTGACCTTGG + Intergenic
1070694292 10:78550676-78550698 ATTTAGAAGCTGTGTGACCTTGG - Intergenic
1071381626 10:85069211-85069233 ATTCAGTAGCTGATGGATCAGGG + Intergenic
1071526214 10:86360996-86361018 TTTTAGTAGCGGAGTGGTCAGGG - Intronic
1071794763 10:88992078-88992100 ATTTACTAGCTGTGTGATCTTGG - Intronic
1071937448 10:90547489-90547511 ATTTTGTAGTTGAGTGACCGTGG - Intergenic
1072209513 10:93233521-93233543 ATTTTGTAGTTGAGTGACTATGG + Intergenic
1072267694 10:93746182-93746204 ATTTAGCAGCTGAGTGACCTTGG - Intergenic
1072481239 10:95810619-95810641 ATTTTGTACCTGAGTGAAGAAGG - Intronic
1072700296 10:97636085-97636107 ATTTACCAGCTGAATGACCATGG + Intronic
1073118836 10:101108790-101108812 ATTTAGTACCTGAGTGGCCTTGG + Intronic
1073535182 10:104269874-104269896 ATTTATTAGCTGGGTGACCTTGG - Intronic
1073591899 10:104765846-104765868 ACTTATTAGCTGAGTGACCTTGG - Intronic
1074121255 10:110496068-110496090 ATTTATTAGCAGATTAAGCAGGG - Intergenic
1074201093 10:111235915-111235937 GCTTAGTAGCTGAGTGATCTTGG + Intergenic
1074274911 10:111991889-111991911 ATTTTGGAGCTGAGTGTGCTTGG - Intergenic
1075564231 10:123492064-123492086 ATTTTGTAGTTGACAGAGCAAGG - Intergenic
1077617187 11:3684987-3685009 ATTTACTAGCTGTGTGACCTTGG + Intronic
1078480364 11:11670239-11670261 ATTTACTAGCTGTGTGACCTTGG + Intergenic
1078532653 11:12148983-12149005 ATTTACTAGGTGTGTGAGCCTGG - Intronic
1078566681 11:12420824-12420846 ATTTACTAGCTGTGTGAACATGG - Intronic
1078849154 11:15148313-15148335 ATTCAGTGGCTTAGTGATCAAGG + Intronic
1078904248 11:15669647-15669669 ATTTATTAGCTGTGTGACCCTGG - Intergenic
1079145971 11:17852210-17852232 ACTTAGTAGCTGAATGACCTTGG - Intronic
1079499323 11:21084927-21084949 ATTTATTAGCAGAGTGACCCTGG + Intronic
1080768712 11:35320938-35320960 CTTTATTAGCAGAGTGAGAATGG - Intronic
1080925526 11:36752209-36752231 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
1081330650 11:41795898-41795920 AGTTAATAGCTGAGTGATGAAGG - Intergenic
1081481096 11:43489969-43489991 ATTCAGTAGTTGAGTGAACTTGG + Intronic
1081794399 11:45809682-45809704 ATTTAGAAGCTGAGTGGCCTGGG - Intronic
1083796713 11:65021186-65021208 ATTTAGTGGCTGTGTGACCTGGG - Intronic
1084021226 11:66419539-66419561 ATGGAGTAGCTGTGTGCGCATGG - Intergenic
1084117002 11:67048408-67048430 ATTTATTTGCTGAGTGACCTGGG + Intronic
1084235049 11:67782368-67782390 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1085074417 11:73577301-73577323 GTTAAGTAGCTGTGTGACCATGG - Intronic
1085614655 11:77987289-77987311 ATTTACTAGCTGGGTGACCTTGG + Intronic
1085749730 11:79150987-79151009 ACATAGTAGCTGAGTGATCCTGG - Intronic
1085760849 11:79240088-79240110 ATTTAATAGCTGTGTGACCCTGG + Intronic
1085834677 11:79939923-79939945 ATTTACTAGCTAAGTGATCTTGG + Intergenic
1085894592 11:80623477-80623499 ATTTACTAGCTGTGTGACCTGGG - Intergenic
1086051617 11:82598595-82598617 ATTTATTAGCTGAGTGACCTTGG + Intergenic
1086159768 11:83708902-83708924 ATTTACTAGTTGAGTGATCTTGG + Intronic
1086316930 11:85605216-85605238 ATTTAGTAGCTGTGTGATCTTGG - Intronic
1086325158 11:85691389-85691411 ACTTAGTAGCTGTGTGACCTTGG - Intergenic
1086397350 11:86430778-86430800 ATTTACTAGCTGTGTGACCTTGG + Intergenic
1087141907 11:94772374-94772396 ATTTAGCAACAGAGTGAGGATGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087917055 11:103823235-103823257 ATTTATTAGCAGTGTGAGAATGG - Intergenic
1088325727 11:108598912-108598934 ATTTATTAGCTGTGTGACCTTGG + Intergenic
1088592103 11:111412724-111412746 ATTTGCTAGCTGAGTGATCTTGG - Intronic
1089183776 11:116600990-116601012 ATTTATTAGCCGAGTGACCTTGG - Intergenic
1089621181 11:119723272-119723294 AATTACTAGCTGAGTGACCTTGG - Intronic
1090073322 11:123562426-123562448 ATTGAGTAGCTGAGACAGCCCGG - Intronic
1090272415 11:125397526-125397548 ATTTACTATCTGTGTGAGCTTGG - Intronic
1090497332 11:127226498-127226520 AATTAGTAACCGAGTTAGCATGG + Intergenic
1091379646 12:48187-48209 ACTTAGTAGCTGTGTGATCTTGG + Intergenic
1091570168 12:1678066-1678088 TTTTAGTTGCTGTGTGAGGAAGG + Intergenic
1091870692 12:3888451-3888473 ATTTACTAGCTGAGTGAGCGTGG + Intergenic
1092099891 12:5874328-5874350 ATTCACTAGCTGAGTGAGCTTGG + Intronic
1092610715 12:10169404-10169426 ATTTACTGGCTGTGTGACCATGG - Intronic
1092835006 12:12479012-12479034 ATTTAGTAGCTGTGTGATTTTGG - Intronic
1093155560 12:15680502-15680524 ATTTATTATCTGAGTGATCTTGG - Intronic
1093942673 12:25071645-25071667 ATTTATTAATTGAGTGATCATGG - Intronic
1094155171 12:27331621-27331643 ATCTACTAGCTGAGTGATCCTGG + Intergenic
1095130044 12:38530314-38530336 AATTAATTGCTGAGTGAGAAAGG + Intergenic
1095837307 12:46652861-46652883 ATTTAATAGATGAGTGACCCTGG + Intergenic
1096531452 12:52245193-52245215 ACTTACTAGCTGTGTGACCATGG - Intronic
1096794889 12:54070439-54070461 ATTGGGAAACTGAGTGAGCATGG + Intergenic
1097729234 12:63108737-63108759 ATTTGGTAGCAGAGTGAAAAAGG + Intergenic
1097978801 12:65715939-65715961 ACTTTTTAGCTGAGTGAGCTGGG - Intergenic
1098084794 12:66830750-66830772 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
1098400538 12:70070687-70070709 TTTTAGCAGCTGAGTGGTCAGGG + Intergenic
1098567814 12:71955546-71955568 ATTTACTAACTGAGTGACCTGGG + Intronic
1099164426 12:79285427-79285449 ATTTACTAGCTGTGTGATCTTGG - Intronic
1099856448 12:88173848-88173870 ATTTACTAGCTGTGTGATCTTGG - Intronic
1100341862 12:93686735-93686757 ATTAACTAGCTGTGTGATCATGG - Intronic
1100951930 12:99860397-99860419 ATTTAGTAGTTTAGGGAGGAAGG + Intronic
1101170186 12:102084116-102084138 ACTTAGTAGCTGTGTGACCTTGG + Intronic
1101663205 12:106785554-106785576 ATTTATTGGATGAGTGACCATGG + Intronic
1101788568 12:107908335-107908357 ATTTAATGGCTGAGTGAGCTTGG - Intergenic
1102394005 12:112573010-112573032 GTTTATTAGCTGTGTGACCACGG + Intronic
1102718539 12:114996123-114996145 ATTTGCTAGCTGTGTGAGCTGGG + Intergenic
1102742666 12:115222154-115222176 ATTTACTAGCTGTGTGATCTTGG - Intergenic
1103014951 12:117486970-117486992 ATTTAGTGGCTGTGTGACCTTGG + Intronic
1103730697 12:123025948-123025970 ATTTAGTAACTGTGTGACCTTGG - Intronic
1106092483 13:26609693-26609715 ATTTGGAACCTGAGTGAACAAGG + Intronic
1106140747 13:27008977-27008999 AATTCGTAAATGAGTGAGCATGG + Intergenic
1106693210 13:32142286-32142308 ATTTATTAGCTGTGTGACCTTGG + Intronic
1106833921 13:33613797-33613819 ATTTAGCAGCAGGGTGAGGAAGG + Intergenic
1108596330 13:51953108-51953130 GTTTGGTGGCTGAGTGAGCCAGG + Intronic
1110136732 13:72076735-72076757 ATTTATTACCTGAGTGTGCTGGG + Intergenic
1110973895 13:81805046-81805068 ATTTAGTAGCCCAGTGACCTTGG + Intergenic
1111809017 13:93074544-93074566 ATTTACTAGTTGTGTGAGCTTGG - Intergenic
1112123530 13:96439558-96439580 ACTTAGCAGCTGTGTGACCATGG + Intronic
1112219139 13:97470400-97470422 AAATAATAGCTGAATGAGCATGG - Intergenic
1112527324 13:100163345-100163367 ACTTAGTAGCTGTGTGATCTTGG + Intronic
1112535776 13:100253951-100253973 ATTTATTAGCAGTGTGAGAATGG - Intronic
1112996092 13:105576352-105576374 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1113964199 13:114143261-114143283 ATTTAGAAGCTGAGTACACAAGG - Intergenic
1114259773 14:21028062-21028084 ATTTACTAGCTGAGTGGACTTGG - Intronic
1115385074 14:32788250-32788272 ACTTAGTAGCTGTGTGATCATGG + Intronic
1116461960 14:45187560-45187582 ATTTTCTAGTTGAGTGATCATGG - Intronic
1116860693 14:49993257-49993279 ATTTAGCAGCTGTGTGATCTTGG + Intronic
1117812994 14:59568208-59568230 ATTCAGTATTTGAGGGAGCAGGG - Intronic
1118193886 14:63606850-63606872 ACTTAGTAGCTATGAGAGCAAGG - Intronic
1118812358 14:69284637-69284659 ACTTACTAGCTGTGTGAACATGG + Intronic
1119569773 14:75660395-75660417 ACTTAGTAGCTGTGTGACCCTGG + Intronic
1119848514 14:77848314-77848336 ATTTACTGGCTGAGTAAGCTTGG + Intronic
1119914475 14:78384417-78384439 ATTAATTAGCTGTGTGACCATGG + Intronic
1120460759 14:84792364-84792386 ATTCAGTTGGGGAGTGAGCATGG - Intergenic
1120477482 14:85006638-85006660 ATTTATAAGCTGTGTGAACATGG + Intergenic
1120571564 14:86124163-86124185 TTGTAGAAGCTGAGTGAGAAAGG + Intergenic
1120930773 14:89846005-89846027 ATTTACAAGCTGAGTGACCTTGG + Intronic
1121898307 14:97669670-97669692 ATTTAGCAGCTAAGTGACCTGGG - Intergenic
1122243910 14:100387674-100387696 ATTTACTAGCTGTGTGACCACGG - Intronic
1122378680 14:101286310-101286332 CTCCAGTAGCTGAGTGACCAGGG - Intergenic
1122526673 14:102390970-102390992 ATTGAGTATCTGAGTCAGGAAGG + Intronic
1124612445 15:31217277-31217299 ACTTAGTAGCTGTGTGATCCTGG - Intergenic
1125065816 15:35485170-35485192 ATTTACTAGCTGTGTGATCCTGG - Intronic
1125441412 15:39707783-39707805 ACTTAGTAGCTGTGTGACCTTGG - Intronic
1126469561 15:48993568-48993590 AATAACTTGCTGAGTGAGCATGG - Intronic
1126814825 15:52444512-52444534 ATTTATTAGCTGAGTGACTTTGG - Intronic
1127016772 15:54697691-54697713 ATTTAGTAAGTGATTGAGCTGGG - Intergenic
1127214972 15:56814644-56814666 ATTTATTAGCTGCGTGACCTTGG - Intronic
1127816393 15:62613074-62613096 CTTAAGTAGCTCAGTGACCATGG + Intronic
1130723588 15:86414885-86414907 ATTTACTAGCTGTGTGACCTTGG + Intronic
1130953175 15:88608187-88608209 TCTGACTAGCTGAGTGAGCAGGG + Intergenic
1131546287 15:93318657-93318679 ATTTCCTAGCTGTGTGACCAAGG - Intergenic
1131854499 15:96579159-96579181 ATTTCCTAGCTGGGTGACCATGG - Intergenic
1131961555 15:97794657-97794679 ATTTACTAGCTGGGTGACCCTGG - Intergenic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1133648838 16:7790294-7790316 ATTTATTAGCAGTGTGAGCTTGG + Intergenic
1133906506 16:10027474-10027496 ATTTACTAGCTGAGTGAGGTTGG + Intronic
1134376739 16:13682916-13682938 ACTTATTAGCTGTGTGATCACGG - Intergenic
1135584578 16:23659085-23659107 AATTAGAGGCTGAGTCAGCAAGG - Intronic
1135717747 16:24787040-24787062 ATTTACTAGCTGTGTGACCATGG - Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136852817 16:33626864-33626886 ATTTATTAGCAGTGTGAGAATGG - Intergenic
1137995521 16:53206550-53206572 ATTCAGTAGCTGTGTGATCTTGG + Intronic
1138045288 16:53716444-53716466 ATTTACTGGCTGAGTGATCTTGG + Intronic
1138908878 16:61372242-61372264 ATTTAATAGATGAGAGAGCCAGG - Intergenic
1140232409 16:73128457-73128479 ATTTATAAGCTGTGTGACCATGG - Intronic
1141898760 16:86976567-86976589 ACTTAGTAGCTGTGTGACCCTGG - Intergenic
1142515617 17:426454-426476 ACTTAGTAGCTGTGTGACCTTGG - Intergenic
1143066017 17:4248054-4248076 ATTTACTAGCTGTGTGACCTTGG + Intronic
1143300445 17:5906086-5906108 ATTTCGTTGTTGTGTGAGCATGG + Intronic
1145905711 17:28515003-28515025 ATATACTAGCTGAGTGAACTTGG + Intronic
1146652627 17:34616030-34616052 ATTTCTTAGCTGTGTGATCATGG - Intronic
1146675483 17:34770775-34770797 ACTTAATAGCTGCGTGAGCTTGG + Intergenic
1146976615 17:37118678-37118700 ATTTTGTAGCTGAATGAGCTTGG + Intronic
1147166189 17:38594730-38594752 ATTTCCTAGCTGTGTGAGCCTGG - Intronic
1147308682 17:39580776-39580798 ATTTGGTAGCTGGGTGATCTTGG - Intergenic
1147316042 17:39620905-39620927 ACTTAGTAGCTGTGTGACCTTGG - Intergenic
1147470756 17:40658621-40658643 ACTTACTAGCTGAGTGACCTTGG - Intronic
1147549667 17:41430848-41430870 ATTTATTAGCTGTGTGAACTTGG + Intergenic
1148539608 17:48469841-48469863 ATCAAGTATCTGAGTGACCAAGG + Intergenic
1148592371 17:48826055-48826077 ACTTATTAGCTATGTGAGCATGG + Intergenic
1148630843 17:49107372-49107394 ACTTTGTAGCTGTGTGACCATGG - Intergenic
1148778441 17:50108790-50108812 ACACAGAAGCTGAGTGAGCAGGG - Intronic
1148903564 17:50896929-50896951 ATTTAGCAGCTGAATAATCACGG + Intergenic
1149774581 17:59347238-59347260 ATTTACTAGCTGTGTGACCTTGG - Intronic
1150352432 17:64456115-64456137 ATTTACTAGCTGTGTGACCTTGG + Intronic
1151248848 17:72817796-72817818 CTTTATTAGCTGCGTGAGAATGG - Intronic
1153611163 18:6886709-6886731 ATTTAGTCGCTGTGTGACCTGGG - Intronic
1155052761 18:22163310-22163332 ATTTACTAGCTATGTGATCATGG - Intergenic
1155781090 18:29837135-29837157 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1156022427 18:32615425-32615447 ACTTGGTAGCTGACTGAACATGG + Intergenic
1156115263 18:33779916-33779938 ATTTAGTAGCTGAATGCCCTTGG + Intergenic
1156159094 18:34338109-34338131 ATTTTGTAGCTGGGTGAACAAGG + Intergenic
1157332068 18:46711394-46711416 ATTTACTAGCTGAATGACCTTGG - Intronic
1157868162 18:51204313-51204335 ATTTAGTTGGTCAGTCAGCAAGG - Intronic
1158750329 18:60251885-60251907 ATTTACTAGCTTTGTGATCATGG + Intergenic
1159161686 18:64650502-64650524 ATTTAGGAGCTGTGTGACCTTGG - Intergenic
1161270972 19:3389127-3389149 ATTTACTCCCTGAGTGTGCACGG - Intronic
1161291552 19:3496450-3496472 ATTTATCACCTGAGTGAGGAAGG + Intronic
1161853185 19:6749435-6749457 ATTTCCTAGCTGTGTGAGCTTGG - Intronic
1162597882 19:11642970-11642992 CTTTATTAGCTGAATGAGAACGG + Intergenic
1163181316 19:15605952-15605974 ATATGGGAGCTGAGTGAACAAGG + Intergenic
1164097368 19:22023515-22023537 ATTTTGTAGTTGAGTGACCGGGG + Intergenic
1164117555 19:22236964-22236986 ATTTTGTAGTTGAGAGACCACGG + Intergenic
1167199531 19:48054812-48054834 TTTTATTAGCAGTGTGAGCATGG + Intronic
925178288 2:1800064-1800086 ATTTATTAGCAGTGTGAGAACGG + Intronic
926025537 2:9540336-9540358 ATTTACTAGCTGAGTAATCTTGG + Intronic
926330858 2:11824144-11824166 ATTTACTAGCTGCGTGATCGTGG - Intronic
926385263 2:12329603-12329625 ATTTAGTAGCTGTGTGAATTGGG - Intergenic
926932049 2:18050470-18050492 ATTTTCTAGCTGTGTGAGCTTGG + Intronic
927049517 2:19313309-19313331 ATTTACTAGCTGTGTGACCTTGG + Intergenic
927422005 2:22943470-22943492 ACTTAATAGCTGGGTGAGCTGGG + Intergenic
927723595 2:25403962-25403984 ATTTACTAGCTGTGTGATCTTGG + Intronic
928261917 2:29775675-29775697 ATTTACTAGCTGGGTGACCTTGG + Intronic
928464250 2:31505525-31505547 ATTTAGTTGCTGACAGTGCAGGG + Intergenic
928862762 2:35878632-35878654 ATTTATTAGCTTTGTGACCAGGG - Intergenic
928912683 2:36438858-36438880 ATTTACTAGCTGTGTGACCTTGG + Intronic
929202663 2:39253563-39253585 AGTTAGTAGCTGGGTGACCTTGG - Intronic
929335447 2:40738541-40738563 ATTGAGTAGCTGAGGAAGAAGGG - Intergenic
929584988 2:43107891-43107913 ACTTACTAGCTGTGTGAGCATGG + Intergenic
929652071 2:43690103-43690125 ATTCTGTAGCTGAGGAAGCAGGG - Intronic
930045870 2:47172333-47172355 ATTTAATAGCTGTGTGACCTTGG + Intronic
930198940 2:48534360-48534382 ACTTAGTGGCTGTGTGACCATGG - Intronic
930691192 2:54367005-54367027 ATTTACTAGCTGGGTGACCTTGG - Intronic
931119544 2:59200422-59200444 ATTTATTAGCAGTGTGAGAATGG + Intergenic
931129020 2:59312180-59312202 ATTTACTAGCTTAGTGAACTTGG - Intergenic
932355712 2:71067124-71067146 ATTTACTAGCTGGATGAGCTTGG - Intronic
932699366 2:73982855-73982877 ACTTACTAGCTGAGTGATCCTGG + Intergenic
933279287 2:80314960-80314982 ATTTAGAAGCTGTGTGATCTGGG + Intronic
933556281 2:83835064-83835086 ATTTGGAAGCTCTGTGAGCAAGG - Intergenic
933900836 2:86849092-86849114 TTTTAGTAGCTGGGTGACCTTGG - Intronic
935121829 2:100189871-100189893 ATTTAATAACTTGGTGAGCAGGG + Intergenic
935560814 2:104557824-104557846 AGTTAGGAGCTGAGTGATAAAGG + Intergenic
935779707 2:106500139-106500161 TTTTAGTAGCTGGGTGACCTTGG + Intergenic
935891844 2:107687615-107687637 ATTTAGCAGCTGTGTAATCATGG + Intergenic
936564214 2:113570638-113570660 ACTTAGTAGCTGTGTGATCTTGG - Intergenic
936771703 2:115921148-115921170 ATTTACTAGCTGTGTGATCTCGG + Intergenic
936930768 2:117786575-117786597 ATTTATTAGCAGTGTGAGAATGG - Intergenic
937235259 2:120427902-120427924 ATTTACTAGCTGTGTGACCTTGG - Intergenic
937444768 2:121948595-121948617 ACTTAATAGCTGGGTGATCATGG + Intergenic
938131905 2:128723807-128723829 AATAATTAGCTAAGTGAGCATGG + Intergenic
938315847 2:130327582-130327604 ATTTGGTAGCTGAGGGAGGGTGG - Intergenic
938607732 2:132913371-132913393 ATTTATTAGCTGTGTGATCTCGG + Intronic
939048163 2:137274418-137274440 ATTAAGTAGCTAAGACAGCATGG + Intronic
939116114 2:138062754-138062776 AATTAGTAGCTCTGTGACCATGG + Intergenic
939678322 2:145099459-145099481 ATGTACTAGCTGAGTGAACCAGG + Intergenic
939994076 2:148903737-148903759 ATTTAGTAGCTATGTGACCTTGG - Intronic
940976229 2:159948136-159948158 ACTTACTAGCTGCGTGACCATGG + Intronic
941006081 2:160248541-160248563 GCTTTGTTGCTGAGTGAGCATGG + Intronic
941449289 2:165640323-165640345 ATTTACTTGCTGGGTGAGCTAGG - Intronic
941931370 2:170943567-170943589 AGTTATTAGCTGTGTGAGCTTGG - Intronic
942145984 2:173026718-173026740 TGTTAGTAGCTGAGATAGCAAGG + Intronic
942197926 2:173541100-173541122 ATTTACTAGCTGCGTGAACTTGG + Intergenic
942423249 2:175830494-175830516 ATTTACTAGCTGTGTGACCTGGG + Intergenic
942505919 2:176641638-176641660 ATTTACTAGCTGTGTGACCTTGG - Intergenic
944303830 2:198156822-198156844 ATTTATTAGCAGTGTGAGAATGG + Intronic
945730452 2:213525630-213525652 ATTTATTAGCAGTGTGAGAATGG + Intronic
946583014 2:221151035-221151057 ATTTAGCAGCTGTGTGACCTTGG - Intergenic
946721691 2:222615568-222615590 ATGTAGGAGCAGAGTAAGCATGG - Intronic
948330051 2:237157415-237157437 ACTCAGTAGCTGAGTGATCACGG - Intergenic
948514715 2:238496888-238496910 ACATAGGAGCTAAGTGAGCAGGG + Intergenic
1169021733 20:2335591-2335613 GCTCAGTAGCTGAGTGAGAAGGG - Intronic
1169432368 20:5549424-5549446 TTTTAGTAGCTGTGTCTGCATGG - Intronic
1169484353 20:6014254-6014276 ACTTAGTAGCTGTGTGATCTTGG - Intronic
1170052742 20:12164668-12164690 ACTTAGAAGTTGAGTGACCATGG - Intergenic
1170959085 20:21009114-21009136 ATTCAGTAGCTGTGTGACCTTGG + Intergenic
1170988992 20:21285032-21285054 ATTTATCAGCTGAGTGACCTTGG + Intergenic
1170991677 20:21307083-21307105 ATTTATCAGCTGAGTGACCTTGG - Intronic
1172195879 20:33091110-33091132 ATTTATTAGCTGTGTGACCTTGG - Intronic
1172441254 20:34968171-34968193 ATTTACAAGCTGAGTGACCCTGG - Intergenic
1173566259 20:44040520-44040542 CTTTAGTAGCTGTGTGATTATGG + Intronic
1173737711 20:45373557-45373579 ACTTTCTAGCTGAGTGAGCCTGG + Exonic
1173803932 20:45911920-45911942 ATTTAGGACCTGAGGGAGCCGGG - Exonic
1173908490 20:46646271-46646293 GTTTAGTAGCTGTGTGACCTTGG + Intronic
1174383039 20:50169732-50169754 ACTTACTAGCTGGGTGAGCCTGG + Intergenic
1174478544 20:50814652-50814674 ATTTATTAGCTGTGTGAGCTTGG + Intronic
1174668190 20:52280623-52280645 ACTTAGTTGTTGAGTCAGCAAGG + Intergenic
1174815237 20:53681572-53681594 ATTTTATAGCTGAGGGAACAGGG - Intergenic
1174846449 20:53948016-53948038 ATCTAGTGGCTGAGTGAGCTTGG - Intronic
1175675341 20:60941952-60941974 ATTTAGAATCTGAGTGATCCAGG + Intergenic
1177060772 21:16371689-16371711 ATATACTAGCTGAATGATCATGG + Intergenic
1177363490 21:20103999-20104021 ATTTTGTAGTTGAGTGACTATGG - Intergenic
1177668444 21:24192694-24192716 AGTTAGTAGCTGAGTGCCAAAGG - Intergenic
1178374720 21:32057227-32057249 CTTTAGTAGCAGTGTGAGAACGG - Intergenic
1178378463 21:32088588-32088610 ACTTACTAGCTGAGTGAACATGG - Intergenic
1178419272 21:32430488-32430510 CTTTATTAGCAGAGTGAGAATGG - Intronic
1178463894 21:32828708-32828730 ACTTACTAGCTGTGTGAGCTTGG - Intergenic
1178686625 21:34716504-34716526 ATTTCTCAGTTGAGTGAGCAAGG + Exonic
1182100239 22:27652673-27652695 ATTTAGGAGCATAGTGAGAAAGG + Intergenic
1182978304 22:34644260-34644282 ATTTAGTAAGTGACTGAGCCAGG - Intergenic
1183020072 22:35019783-35019805 ACTTCGTAGCTGTGTGAGCTTGG - Intergenic
949208017 3:1463924-1463946 ATTTACTAGATGTGTGACCATGG - Intergenic
949573374 3:5314753-5314775 ATTTACTAGCTGTGTGACCTTGG + Intergenic
949977145 3:9471322-9471344 ATTTACTAGCTGTGTGACCACGG - Intronic
950298348 3:11851389-11851411 ATTTAATAGCTGTGTGACCTTGG + Intergenic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
954090663 3:48281481-48281503 ACTTATTAGCTGTGTGAACATGG - Intronic
954115575 3:48465348-48465370 TTGCAGTAGCTGAGGGAGCAGGG + Intronic
955529748 3:59860892-59860914 ATTTACTAGCTGGGGGATCATGG - Intronic
955737567 3:62055991-62056013 GCTTACTAGCTGAGTGAGCTTGG - Intronic
955798846 3:62665767-62665789 ACTTAGTAGCTGTGTGACCTTGG + Intronic
956402067 3:68890634-68890656 ACTTACTAGCTAAGTGAGCTTGG - Intronic
957291651 3:78284481-78284503 ATTTACTAGCTGAGTGACCTAGG + Intergenic
958253693 3:91300039-91300061 CTTTAGTAGTTGAGAGGGCATGG - Intergenic
958433175 3:94065942-94065964 ACTTATTAGCTGAGTGAACTTGG - Intronic
958555506 3:95670713-95670735 ACTTACTAGCTGTGTGAACATGG - Intergenic
958923388 3:100131211-100131233 ATTTACAAGCTGTGTGAGCTTGG - Intronic
959333490 3:105035794-105035816 TTTTAGAAGCTGAGAGAGCAAGG - Intergenic
959380455 3:105635171-105635193 ATTTATTAGTTGTGTGATCAGGG + Intergenic
961884691 3:130088897-130088919 CTTTATTAGCAGAGTGAGAATGG + Intronic
962549813 3:136478873-136478895 ATTTACTAGCTGTGTGACCTTGG + Intronic
962714070 3:138112217-138112239 ATTTAGTAGCTGAGTGAGCAGGG - Intronic
962848963 3:139293722-139293744 ATTTATTAGCTGTGTGACCCTGG + Intronic
963212419 3:142707942-142707964 ATTTAGTATCTGTGTGACCATGG + Intronic
963355906 3:144208699-144208721 ATTTTGTAGCTGAGTGACTGTGG + Intergenic
964462245 3:156946547-156946569 ATTTAGTATCATACTGAGCAGGG - Intronic
965006567 3:163033984-163034006 CTTTAGTAGCAGCGTGAGAACGG + Intergenic
965573788 3:170197489-170197511 ATTTACTAGCTGTGTGACCTTGG - Intergenic
967484888 3:190018732-190018754 ATTAAGTAGTGGAGTTAGCAAGG - Intronic
968039685 3:195578755-195578777 ATTTACCAGCTGCGTGAGCTGGG + Intronic
968337521 3:197925970-197925992 ATTTAATAGCTGTGTTAGCTCGG + Intronic
969410740 4:7026388-7026410 AGTTAGTAGCTGAGTGGTAACGG - Intronic
969820097 4:9713391-9713413 CTTTATTAGCAGAGTGAGAAAGG - Intergenic
969883383 4:10194554-10194576 ATTTACTAGTTGAGTGAGCTTGG + Intergenic
970211567 4:13715523-13715545 ATTTATTAACTGGGTTAGCAAGG - Intergenic
970269986 4:14335988-14336010 CTTTGGTAGCTGTGTGAGCTTGG - Intergenic
970310659 4:14778960-14778982 ATTTATTAGCTGGGTGACCCTGG + Intergenic
970377280 4:15471671-15471693 ATTTATTAGCTGTGTGATCTTGG - Intronic
970427581 4:15959650-15959672 ATTTAATTGCTGAGTGTACAGGG + Intergenic
970731218 4:19105848-19105870 AGTTAGTAGGTGAAAGAGCAGGG - Intergenic
971502822 4:27334806-27334828 GTTTATTAGGTGTGTGAGCAAGG + Intergenic
972286103 4:37649968-37649990 ATTTAGCAGCTGTGTGACAATGG + Intronic
972423175 4:38909169-38909191 ACTTAGTAGCTGAGTGACCTTGG + Intronic
972631243 4:40843841-40843863 ATGTAGTAGCTGTGTGACCTTGG - Intronic
972725525 4:41743852-41743874 ATTTAGTGCTTGAGAGAGCAGGG - Intergenic
972751049 4:41989858-41989880 AGTTAAGAGCTGAATGAGCATGG + Intergenic
974686486 4:65237948-65237970 ATTTAGAAGCTGAATGACCTGGG - Intergenic
974936643 4:68416617-68416639 ATTTACTAGCTGTGTGACCTAGG - Intergenic
975655177 4:76634080-76634102 GTTTATTAGCAGAGTGAGAATGG - Intronic
975733945 4:77363882-77363904 ATTTTGTAGTTGAGTGACCGTGG + Intronic
975840886 4:78472547-78472569 ATTTAGGAGTTGAGGAAGCACGG - Intronic
976145607 4:82040119-82040141 ACTTAGTAGGTGAGTGACCTTGG + Intronic
976391132 4:84504985-84505007 ACTTAGTAGCTGTGTGATCTTGG - Intergenic
976628822 4:87216983-87217005 ACTTATTGGCTGTGTGAGCATGG - Intronic
977274152 4:94954641-94954663 ATTTATGAGCTGAGTGATCTTGG + Intronic
978426275 4:108586025-108586047 ATTAACTAGCTGTGTGACCATGG + Intergenic
979075478 4:116264546-116264568 ATTTTGTAGTTGAGTGACCATGG - Intergenic
979656854 4:123205309-123205331 ATTTAGTAGCTGTATGAACCTGG + Intronic
980654718 4:135766899-135766921 CTTTATTAGCTGTGTGAGAATGG - Intergenic
981462553 4:145029942-145029964 ATTTTGTAGTTGAGTGACCGTGG - Intronic
982627018 4:157780173-157780195 TTTTTATAGCTGAGTGAGAATGG + Intergenic
983075549 4:163321393-163321415 ATTTACTAGCTGAGTGACACTGG + Intergenic
983520918 4:168708078-168708100 ATTTATTAGCTGTGTGACCTTGG + Intronic
983954192 4:173677734-173677756 ATATAGAAGGTGAATGAGCAAGG + Intergenic
984008307 4:174340428-174340450 CTTTATTAGCTGCGTGAGAACGG - Intergenic
984239995 4:177206770-177206792 ATTTATTAGCTGTGTGACCTTGG - Intergenic
984279280 4:177649233-177649255 TTTTAGTAACTGAGTGGGAATGG - Intergenic
984407970 4:179357973-179357995 ATTTAGTTGCTGGCTGAGGATGG - Intergenic
984651805 4:182278401-182278423 ATGTACTAGCTGGGTGAGCTGGG + Intronic
984859489 4:184224352-184224374 ATTTAGTAGCTGAGTGGTAAGGG + Intergenic
985084351 4:186297588-186297610 GTGAAGGAGCTGAGTGAGCAGGG - Intergenic
986627619 5:9737331-9737353 ACTTATTAGCTGAGTGACCTTGG + Intergenic
987165660 5:15195369-15195391 CTTTATTAGCAGAGTGAGAATGG - Intergenic
987627362 5:20419305-20419327 ATTTATTAGCAGCGTGAACACGG + Intronic
990017902 5:51088583-51088605 ACTTATTAGCTGAGTGAACTTGG + Intergenic
990366323 5:55074403-55074425 ATTTATTAGCTGTGTGAACTAGG + Intergenic
990594796 5:57302016-57302038 CTTTATTAGCAGAGTGAGAATGG - Intergenic
991945898 5:71898282-71898304 ATTTTGTAGCTGAGTGACTGTGG - Intergenic
992134960 5:73735379-73735401 ATTTAGTAGCAGAGGCAGCCAGG + Intronic
992225986 5:74620210-74620232 ATTGAGTGACTGAGTTAGCATGG - Intergenic
994735076 5:103543355-103543377 ATTTAAATTCTGAGTGAGCACGG + Intergenic
995209974 5:109526573-109526595 ATTTACTAGCTGTGTGATCTTGG + Intergenic
995603598 5:113826334-113826356 ACTTAGTAGCTGGGTGACCTTGG + Intergenic
996111125 5:119568072-119568094 ACTTTGGAGCTGAGTGAGCTGGG - Intronic
996196962 5:120620682-120620704 ATTTAGCAGCTGAGGAAGCAAGG - Intronic
998142491 5:139708110-139708132 ATTTACTAGCTGAGTGACCTTGG - Intergenic
998756785 5:145390280-145390302 ATTTATTAGAAGAGTGAGAATGG - Intergenic
998861232 5:146446322-146446344 ATTTAGTAGATGTGTGACCTTGG + Intergenic
998946792 5:147348590-147348612 ATCTTGTAGCTGAGTCAGCTTGG + Intronic
999080513 5:148839020-148839042 GTTTACTAGCAGAGTCAGCAAGG + Intergenic
999269988 5:150291274-150291296 ATTTATTAGCTGAGTGATCACGG + Intergenic
999431627 5:151529776-151529798 ATTTACTAGCTGGGTGAGGTTGG - Intronic
999492715 5:152067292-152067314 GTTTACTAGCTGTGTGAGCTTGG + Intergenic
999822690 5:155244114-155244136 ATTTATTAGCAGCGTGAGAATGG - Intergenic
999858172 5:155617755-155617777 ATTTAGTAGCTGTGTGACCTTGG - Intergenic
1001012006 5:168107270-168107292 GGTTGGTAGCCGAGTGAGCAGGG - Intronic
1001086631 5:168704751-168704773 ATTGACTAGCTGAGTGACCTTGG - Intronic
1001131325 5:169066049-169066071 ATTTACTAGCTTTGTGAGCTTGG - Intronic
1001134860 5:169094106-169094128 ATTTATTAGCTGTGTGATCTTGG - Intronic
1001716337 5:173819202-173819224 ACTTAGTAGCTGAGTGATATTGG + Intergenic
1002192620 5:177486435-177486457 ATCTACTGGCTGTGTGAGCAGGG - Intronic
1003516305 6:6821690-6821712 ACTTAGTAGCTGTGTGATCTTGG + Intergenic
1003767715 6:9260332-9260354 ATTTATTAGCAGTGTGAGAATGG - Intergenic
1003821500 6:9902601-9902623 ATTTACTAGCTGTGTGACCCTGG - Intronic
1004210245 6:13633562-13633584 ATTTACTAGCTGTGTGACCTTGG - Intronic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1006921006 6:37627137-37627159 ACTTACTAGCTGTGTGACCATGG - Intergenic
1007252328 6:40504248-40504270 ACTTAGTAGCTGTGTGACCTTGG + Intronic
1009190780 6:60626999-60627021 CTTTAGTAGTTGAGAGGGCATGG + Intergenic
1009485866 6:64220852-64220874 ATTTACTGGCTGAGTAACCATGG + Intronic
1011033846 6:82952218-82952240 ACTTATTAGCTGTGTGAGCTTGG + Intronic
1011166699 6:84455622-84455644 ATTAACTAGCTGAGTGATCCTGG + Intergenic
1011881832 6:92038097-92038119 ATTAAGTTGCTCAGGGAGCAGGG - Intergenic
1013082285 6:106823220-106823242 ACTTAGCAGCTGTGTGACCATGG + Intergenic
1013624607 6:111924990-111925012 ATTCAGGAGCTGATTCAGCAGGG - Intergenic
1013723963 6:113069571-113069593 TTTTATTAGCTGCGTGAGAATGG - Intergenic
1014363015 6:120504092-120504114 TTTTATTAGCAGAGTGAGAATGG + Intergenic
1014575197 6:123060811-123060833 GTTTACTAGCTGTGTGATCATGG - Intronic
1015331593 6:131985909-131985931 ATTTAGTAGCTGGGTGACTTAGG + Intergenic
1015403339 6:132811560-132811582 ATTTATTAGCTGTGTGATCTTGG + Intergenic
1015875335 6:137816880-137816902 ACTTAGTAGCTGTGTGACAAGGG - Intergenic
1016595985 6:145801789-145801811 CTTTTGTAGCTTTGTGAGCATGG - Intronic
1016941610 6:149486929-149486951 ATTAAGTGGCTGAGTGAAGATGG + Intergenic
1017234792 6:152108219-152108241 ATTTGGTGGATGAGTGTGCAGGG - Intronic
1017448135 6:154528178-154528200 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1018448954 6:163887590-163887612 ATTTAGTAGAAGACTGACCAGGG - Intergenic
1018519879 6:164636069-164636091 ATTTTGTGGCTCAGTGATCATGG + Intergenic
1018721795 6:166578421-166578443 ATGTAGGAGCTGGGTGACCAGGG + Intronic
1019092806 6:169553564-169553586 ATTTAGTAACTTAGTGGCCAGGG + Intronic
1019790056 7:3005909-3005931 ACTTACTGGCTGAGTGAGGAGGG + Intronic
1019820382 7:3238588-3238610 ATTTACTAGCTGGGTGACCTTGG - Intergenic
1020318069 7:6920906-6920928 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1020396464 7:7723680-7723702 ATTTTGTAGTTGAGTGACTATGG - Intronic
1021009751 7:15447492-15447514 ATTCAGAAGCTGTGTGACCATGG + Intronic
1021031686 7:15745017-15745039 ATTTTCTAGCTGAGTGACCATGG + Intergenic
1021175103 7:17440910-17440932 ATGTATTAGCAGTGTGAGCATGG - Intergenic
1021315126 7:19139244-19139266 ATTTGTTAGCTGATTGAGCTTGG + Intergenic
1021392008 7:20104140-20104162 ATTCAGTAGCTGTGTGACCTTGG + Intergenic
1021482280 7:21130867-21130889 ATTTAGAAGCTGGTTGACCATGG - Intergenic
1023585616 7:41726676-41726698 ACTGAGTAGCTGTGTGACCATGG - Intergenic
1023837516 7:44077052-44077074 ATTTAGGAGCAGAGTTGGCAGGG + Intronic
1024510526 7:50200623-50200645 ATTTATTAGCTGTGTGACCGTGG + Intergenic
1027868622 7:83677834-83677856 AATTATGAGCTGTGTGAGCATGG - Intergenic
1028028923 7:85884183-85884205 ATTTAGTAGCTGCGTGACTTTGG - Intergenic
1028568162 7:92256189-92256211 CTTTAGTAGTTTAGTGGGCAGGG + Intronic
1028682444 7:93552137-93552159 ATTTATCAGCTGAGTGATCTTGG + Intronic
1029520910 7:101061586-101061608 ATTTACTACCTGCGTGAGCTTGG + Intergenic
1029936309 7:104428076-104428098 ATTTAAAAACTAAGTGAGCAAGG - Intronic
1029961828 7:104695872-104695894 ATTTAGAAAATGAGGGAGCAAGG - Intronic
1030219373 7:107080898-107080920 ATTTATTAGCTGTGTGACCTTGG + Intronic
1031175315 7:118341301-118341323 CTTTATTAGCAGTGTGAGCATGG + Intergenic
1031951475 7:127897015-127897037 ATTTTGTAGCTGATTGTGAACGG + Intronic
1032390705 7:131553757-131553779 TTTCAGTAGCTGAGGGAACACGG + Intronic
1032507997 7:132450566-132450588 TCTCAGTAGCTGAGTGACCAAGG - Intronic
1032576119 7:133056878-133056900 ATTTAATAGTTGTGTGATCATGG - Intronic
1032739969 7:134729340-134729362 ATTTACTAGCTGGGTGACCATGG - Intergenic
1034262966 7:149768416-149768438 ATTTACTAGCTGAGTGCCCTTGG - Intronic
1034298934 7:149998389-149998411 CTTTATTAGCTGTGTGAGAATGG - Intergenic
1034419824 7:150984026-150984048 ATTGAGTAGCCAAGTGAGCTTGG - Intergenic
1034496384 7:151425611-151425633 ATTTAGCAGCTCTGTGAGCTTGG + Intergenic
1034807081 7:154098387-154098409 CTTTATTAGCTGTGTGAGAATGG + Intronic
1036180882 8:6584218-6584240 ATTTAGCAGCTCAGGGAGGAAGG + Intronic
1037591052 8:20312457-20312479 ACTTAGCAGCTGAGTGACCTTGG + Intergenic
1038072228 8:24029787-24029809 GTTCATTAGCTGAGTGAGCCTGG + Intergenic
1038724355 8:30067175-30067197 TTCTAGTAGCTGATTGAGCAGGG - Intronic
1039966480 8:42287739-42287761 ATTTACTAGCTGTGTGACCTTGG - Intronic
1040068729 8:43171527-43171549 ATTTGGTACCTGAGTGAGCTTGG - Intronic
1042106085 8:65327579-65327601 AGTTAGTAGCTGTGTGATCTTGG - Intergenic
1042363678 8:67911663-67911685 TTTTAGAAGCTGAGAGAGGATGG - Intergenic
1042518721 8:69687223-69687245 ATTTAGTAGCTATGTGACCTTGG + Intronic
1043106330 8:76116434-76116456 ATTTACTAGCTATGTGAGCTAGG + Intergenic
1043257762 8:78157505-78157527 ATTTTGTGGTTGAGTGACCACGG - Intergenic
1043488217 8:80720025-80720047 ATTTAATAGCTGTGTGACCTTGG - Intronic
1045251067 8:100483956-100483978 CTTTATTAGCAGAGTGAGAATGG + Intergenic
1046054971 8:109068459-109068481 ATTTACTAGCTGTGTGACCTTGG - Intergenic
1046509194 8:115178027-115178049 TTTTAGTAGCAGACTGAACATGG + Intergenic
1046585296 8:116143047-116143069 ATTTAATAGCTGAGTGTGTTGGG + Intergenic
1047338429 8:123957605-123957627 ATTTATTAGCTGTGTGACCTGGG - Intronic
1047355319 8:124115802-124115824 ATTTACTAGCTGTGTGATCTTGG - Intronic
1047362605 8:124182991-124183013 ACTTAGTGGCTGTGTGAACATGG + Intergenic
1047399966 8:124538191-124538213 ATTTAGCAGCTGAGTGTTCATGG - Intronic
1047504127 8:125465471-125465493 ACTTAGCAGCTGAGTGATCATGG - Intergenic
1048171355 8:132109712-132109734 CTTTAGTATCTGAGAGACCATGG - Intronic
1048720712 8:137321116-137321138 ATTTATTAGCTGTGTGAACCTGG + Intergenic
1048901173 8:139039325-139039347 ACTTACTAGCTGTGTGACCATGG + Intergenic
1049888308 9:43466-43488 ACTTAGTAGCTGAGTGATCTTGG + Intergenic
1050110460 9:2210062-2210084 ATTTGCTAGCTGAGTGACCCTGG - Intergenic
1050189441 9:3009669-3009691 CTTTAGTAGCAGCGTGAGAACGG - Intergenic
1050494383 9:6225449-6225471 ATTTACTAGCTGTGTGACCTTGG + Intronic
1050664268 9:7917636-7917658 ATTTGGTAGCTGAATGACCCTGG + Intergenic
1050669518 9:7980278-7980300 ATTTAGGATCTGAGTGTTCAGGG - Intergenic
1051181344 9:14415132-14415154 ATTAAGAACCTGAGTGAGCTTGG - Intergenic
1051681932 9:19616405-19616427 ATTTACTAGCTGTGTGACCTCGG - Intronic
1051794810 9:20854477-20854499 ATTTGGTAGCTGTGTGACTATGG - Intronic
1051908124 9:22119994-22120016 AGTTAGTAGCTGTGTGATCTTGG + Intergenic
1055652672 9:78422088-78422110 ATTTAGTTGCTGTGTGATCTTGG + Intergenic
1056542764 9:87588076-87588098 ATTTACTAGCTGTGTGATCTTGG - Intronic
1057142496 9:92735811-92735833 ACTTAGGGCCTGAGTGAGCAAGG - Intronic
1057821403 9:98333856-98333878 ATTTACCAGCTGTGTGACCATGG + Intronic
1057886662 9:98834805-98834827 ATTTAGAAGCATAGAGAGCAAGG - Intronic
1058381359 9:104380352-104380374 ATTTAATAGCTGAGGGAGGGTGG - Intergenic
1058387716 9:104458586-104458608 ACTTACTAGCTGTGTGAGCTTGG + Intergenic
1058873254 9:109220540-109220562 ATTTTGAAGCTGTGTAAGCAGGG + Intronic
1058948128 9:109877750-109877772 ATTTACCAGCTGAGTGAGCTTGG - Intronic
1059148210 9:111921359-111921381 ATTTAGTTGTTGACTGAGCATGG + Intronic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1059261945 9:112985538-112985560 ATTTAGAAGCTGGGTGGCCATGG + Intergenic
1059314589 9:113413200-113413222 ATTTAATAGCTGAGTGACCTGGG - Intronic
1059803596 9:117774818-117774840 ACTTAGTAGTTGTGTGAGCTTGG - Intergenic
1060803912 9:126563259-126563281 ATTTAGTAGCTAAGTGATCATGG - Intergenic
1060814815 9:126629475-126629497 ATTTACTAGCTGTGTGACCTTGG - Intronic
1060856498 9:126917838-126917860 GTTTCTTAGCTGAGTGAGGAGGG + Intronic
1186257629 X:7739948-7739970 ATTTTCTAGCTGTGTGACCAGGG - Intergenic
1186799327 X:13077562-13077584 ATTTAGTAGCTGTGTGTCCTTGG + Intergenic
1188564787 X:31513903-31513925 ATTTATTAGCTGTGTGAACCTGG - Intronic
1188929181 X:36084985-36085007 ACCTACTAGCTGAGTGAGTATGG - Intronic
1190938406 X:55017220-55017242 ATTTACTAGCTGTGTGACCTTGG + Intronic
1191659052 X:63631848-63631870 ATTTTGTAGTTCAGTGACCATGG + Intergenic
1191682262 X:63853212-63853234 ATTTACCAGCTGTGTGACCATGG - Intergenic
1191720985 X:64228462-64228484 ATTTAGTAGCTGTGTGACCTGGG + Intronic
1191891680 X:65949977-65949999 ATTTAGGAGCTGTGTGGTCAGGG - Intergenic
1192083183 X:68067946-68067968 ATTTAGTAGCTGTGTTAGTTGGG + Intronic
1192248207 X:69390172-69390194 ATTTACTAGTTGAGTGACCTTGG - Intergenic
1192297958 X:69869849-69869871 ATTTTGTAGTTGAGTGACTATGG + Intronic
1192497740 X:71627300-71627322 ATTTACTAGCTTTGTGACCACGG + Intergenic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1193011888 X:76685841-76685863 CTGTAGTAGATGAGTGAGGAAGG + Intergenic
1193787183 X:85773330-85773352 ATTTACTAGCTGTGTGATCTTGG - Intergenic
1194049495 X:89052149-89052171 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1194714091 X:97270431-97270453 ACTTAGTAGCTGTGTGACCTTGG - Intronic
1194794679 X:98197151-98197173 ACTTAGTGGCTGAGTGATCTTGG + Intergenic
1194956764 X:100190143-100190165 ATTTACTAGCTGTGTGACCTTGG - Intergenic
1194959363 X:100217354-100217376 ACTTAGAAGCTGTGTGAGCTTGG - Intergenic
1195008350 X:100709569-100709591 ATTTACTAGCTGTGTGACCTTGG + Intronic
1196329601 X:114455541-114455563 ATTTACTAGCTGTGTGATCTTGG - Intergenic
1196580479 X:117373597-117373619 ATTTAGTAGCTATGTGATCTTGG + Intergenic
1197198806 X:123731656-123731678 CTTAAGTAGCTGAGTGACCTTGG - Intronic
1197652503 X:129081105-129081127 ATTTACTAGCTGTGTGACCATGG - Intergenic
1198473485 X:136972697-136972719 ACTTACTAGCTGAATGACCATGG - Intergenic
1198608898 X:138375232-138375254 CTTTATTAGCAGAGTGAGAATGG - Intergenic
1199386299 X:147226955-147226977 GTTTAGTAGATGAATGAGAATGG - Intergenic
1199509595 X:148607142-148607164 TTTTACTAGCTTAGTGAGCATGG - Intronic