ID: 962714521

View in Genome Browser
Species Human (GRCh38)
Location 3:138115260-138115282
Sequence AGCGGGGCGGGTGGGTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714521_962714531 -5 Left 962714521 3:138115260-138115282 CCAAGCTACCCACCCGCCCCGCT 0: 1
1: 0
2: 0
3: 13
4: 246
Right 962714531 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 1
4: 37
962714521_962714540 29 Left 962714521 3:138115260-138115282 CCAAGCTACCCACCCGCCCCGCT 0: 1
1: 0
2: 0
3: 13
4: 246
Right 962714540 3:138115312-138115334 CGCGCGGCCCGCTCACCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
962714521_962714537 27 Left 962714521 3:138115260-138115282 CCAAGCTACCCACCCGCCCCGCT 0: 1
1: 0
2: 0
3: 13
4: 246
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714521_962714535 13 Left 962714521 3:138115260-138115282 CCAAGCTACCCACCCGCCCCGCT 0: 1
1: 0
2: 0
3: 13
4: 246
Right 962714535 3:138115296-138115318 CCTGGCATAGTTTTCCCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
962714521_962714539 28 Left 962714521 3:138115260-138115282 CCAAGCTACCCACCCGCCCCGCT 0: 1
1: 0
2: 0
3: 13
4: 246
Right 962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714521 Original CRISPR AGCGGGGCGGGTGGGTAGCT TGG (reversed) Intronic