ID: 962714525

View in Genome Browser
Species Human (GRCh38)
Location 3:138115269-138115291
Sequence CGTCCCGGGAGCGGGGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 397}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714525_962714540 20 Left 962714525 3:138115269-138115291 CCACCCGCCCCGCTCCCGGGACG 0: 1
1: 0
2: 2
3: 52
4: 397
Right 962714540 3:138115312-138115334 CGCGCGGCCCGCTCACCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
962714525_962714543 28 Left 962714525 3:138115269-138115291 CCACCCGCCCCGCTCCCGGGACG 0: 1
1: 0
2: 2
3: 52
4: 397
Right 962714543 3:138115320-138115342 CCGCTCACCGTGGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112
962714525_962714535 4 Left 962714525 3:138115269-138115291 CCACCCGCCCCGCTCCCGGGACG 0: 1
1: 0
2: 2
3: 52
4: 397
Right 962714535 3:138115296-138115318 CCTGGCATAGTTTTCCCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
962714525_962714539 19 Left 962714525 3:138115269-138115291 CCACCCGCCCCGCTCCCGGGACG 0: 1
1: 0
2: 2
3: 52
4: 397
Right 962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
962714525_962714537 18 Left 962714525 3:138115269-138115291 CCACCCGCCCCGCTCCCGGGACG 0: 1
1: 0
2: 2
3: 52
4: 397
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714525 Original CRISPR CGTCCCGGGAGCGGGGCGGG TGG (reversed) Intronic