ID: 962714526

View in Genome Browser
Species Human (GRCh38)
Location 3:138115272-138115294
Sequence ATTCGTCCCGGGAGCGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714526_962714535 1 Left 962714526 3:138115272-138115294 CCCGCCCCGCTCCCGGGACGAAT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962714535 3:138115296-138115318 CCTGGCATAGTTTTCCCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
962714526_962714543 25 Left 962714526 3:138115272-138115294 CCCGCCCCGCTCCCGGGACGAAT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962714543 3:138115320-138115342 CCGCTCACCGTGGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112
962714526_962714539 16 Left 962714526 3:138115272-138115294 CCCGCCCCGCTCCCGGGACGAAT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
962714526_962714540 17 Left 962714526 3:138115272-138115294 CCCGCCCCGCTCCCGGGACGAAT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962714540 3:138115312-138115334 CGCGCGGCCCGCTCACCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
962714526_962714537 15 Left 962714526 3:138115272-138115294 CCCGCCCCGCTCCCGGGACGAAT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714526 Original CRISPR ATTCGTCCCGGGAGCGGGGC GGG (reversed) Intronic