ID: 962714529

View in Genome Browser
Species Human (GRCh38)
Location 3:138115277-138115299
Sequence CAGGAATTCGTCCCGGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714529_962714537 10 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714529_962714546 27 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714546 3:138115327-138115349 CCGTGGGGTCTCCTGGAGCCGGG 0: 1
1: 0
2: 4
3: 30
4: 343
962714529_962714543 20 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714543 3:138115320-138115342 CCGCTCACCGTGGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112
962714529_962714539 11 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
962714529_962714547 28 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714547 3:138115328-138115350 CGTGGGGTCTCCTGGAGCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 197
962714529_962714540 12 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714540 3:138115312-138115334 CGCGCGGCCCGCTCACCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
962714529_962714535 -4 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714535 3:138115296-138115318 CCTGGCATAGTTTTCCCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
962714529_962714544 26 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714544 3:138115326-138115348 ACCGTGGGGTCTCCTGGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714529 Original CRISPR CAGGAATTCGTCCCGGGAGC GGG (reversed) Intronic