ID: 962714530

View in Genome Browser
Species Human (GRCh38)
Location 3:138115278-138115300
Sequence CCAGGAATTCGTCCCGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714530_962714546 26 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714546 3:138115327-138115349 CCGTGGGGTCTCCTGGAGCCGGG 0: 1
1: 0
2: 4
3: 30
4: 343
962714530_962714537 9 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714530_962714543 19 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714543 3:138115320-138115342 CCGCTCACCGTGGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112
962714530_962714539 10 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
962714530_962714547 27 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714547 3:138115328-138115350 CGTGGGGTCTCCTGGAGCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 197
962714530_962714544 25 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714544 3:138115326-138115348 ACCGTGGGGTCTCCTGGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 170
962714530_962714535 -5 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714535 3:138115296-138115318 CCTGGCATAGTTTTCCCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
962714530_962714540 11 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714540 3:138115312-138115334 CGCGCGGCCCGCTCACCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714530 Original CRISPR CCAGGAATTCGTCCCGGGAG CGG (reversed) Intronic