ID: 962714532

View in Genome Browser
Species Human (GRCh38)
Location 3:138115283-138115305
Sequence CTATGCCAGGAATTCGTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714532_962714540 6 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714540 3:138115312-138115334 CGCGCGGCCCGCTCACCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
962714532_962714544 20 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714544 3:138115326-138115348 ACCGTGGGGTCTCCTGGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 170
962714532_962714550 30 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714550 3:138115336-138115358 CTCCTGGAGCCGGGGACGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 280
962714532_962714535 -10 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714535 3:138115296-138115318 CCTGGCATAGTTTTCCCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 36
962714532_962714539 5 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
962714532_962714547 22 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714547 3:138115328-138115350 CGTGGGGTCTCCTGGAGCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 197
962714532_962714548 26 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714548 3:138115332-138115354 GGGTCTCCTGGAGCCGGGGACGG 0: 1
1: 0
2: 3
3: 45
4: 415
962714532_962714543 14 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714543 3:138115320-138115342 CCGCTCACCGTGGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112
962714532_962714546 21 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714546 3:138115327-138115349 CCGTGGGGTCTCCTGGAGCCGGG 0: 1
1: 0
2: 4
3: 30
4: 343
962714532_962714537 4 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714532_962714549 29 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714549 3:138115335-138115357 TCTCCTGGAGCCGGGGACGGCGG 0: 1
1: 0
2: 1
3: 40
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714532 Original CRISPR CTATGCCAGGAATTCGTCCC GGG (reversed) Intronic