ID: 962714533

View in Genome Browser
Species Human (GRCh38)
Location 3:138115284-138115306
Sequence ACTATGCCAGGAATTCGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 88}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714533_962714547 21 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714547 3:138115328-138115350 CGTGGGGTCTCCTGGAGCCGGGG 0: 1
1: 0
2: 0
3: 24
4: 197
962714533_962714549 28 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714549 3:138115335-138115357 TCTCCTGGAGCCGGGGACGGCGG 0: 1
1: 0
2: 1
3: 40
4: 424
962714533_962714546 20 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714546 3:138115327-138115349 CCGTGGGGTCTCCTGGAGCCGGG 0: 1
1: 0
2: 4
3: 30
4: 343
962714533_962714543 13 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714543 3:138115320-138115342 CCGCTCACCGTGGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112
962714533_962714550 29 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714550 3:138115336-138115358 CTCCTGGAGCCGGGGACGGCGGG 0: 1
1: 0
2: 2
3: 18
4: 280
962714533_962714537 3 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714533_962714540 5 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714540 3:138115312-138115334 CGCGCGGCCCGCTCACCGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 65
962714533_962714539 4 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714539 3:138115311-138115333 CCGCGCGGCCCGCTCACCGTGGG 0: 1
1: 0
2: 0
3: 5
4: 53
962714533_962714548 25 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714548 3:138115332-138115354 GGGTCTCCTGGAGCCGGGGACGG 0: 1
1: 0
2: 3
3: 45
4: 415
962714533_962714544 19 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714544 3:138115326-138115348 ACCGTGGGGTCTCCTGGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714533 Original CRISPR ACTATGCCAGGAATTCGTCC CGG (reversed) Intronic