ID: 962714537

View in Genome Browser
Species Human (GRCh38)
Location 3:138115310-138115332
Sequence CCCGCGCGGCCCGCTCACCG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 142}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962714521_962714537 27 Left 962714521 3:138115260-138115282 CCAAGCTACCCACCCGCCCCGCT 0: 1
1: 0
2: 0
3: 13
4: 246
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714526_962714537 15 Left 962714526 3:138115272-138115294 CCCGCCCCGCTCCCGGGACGAAT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714527_962714537 14 Left 962714527 3:138115273-138115295 CCGCCCCGCTCCCGGGACGAATT 0: 1
1: 0
2: 1
3: 2
4: 55
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714528_962714537 11 Left 962714528 3:138115276-138115298 CCCCGCTCCCGGGACGAATTCCT 0: 1
1: 0
2: 0
3: 2
4: 41
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714529_962714537 10 Left 962714529 3:138115277-138115299 CCCGCTCCCGGGACGAATTCCTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714532_962714537 4 Left 962714532 3:138115283-138115305 CCCGGGACGAATTCCTGGCATAG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714534_962714537 -9 Left 962714534 3:138115296-138115318 CCTGGCATAGTTTTCCCGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 11
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714530_962714537 9 Left 962714530 3:138115278-138115300 CCGCTCCCGGGACGAATTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714525_962714537 18 Left 962714525 3:138115269-138115291 CCACCCGCCCCGCTCCCGGGACG 0: 1
1: 0
2: 2
3: 52
4: 397
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714524_962714537 19 Left 962714524 3:138115268-138115290 CCCACCCGCCCCGCTCCCGGGAC 0: 1
1: 1
2: 1
3: 27
4: 318
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142
962714533_962714537 3 Left 962714533 3:138115284-138115306 CCGGGACGAATTCCTGGCATAGT 0: 1
1: 0
2: 2
3: 2
4: 88
Right 962714537 3:138115310-138115332 CCCGCGCGGCCCGCTCACCGTGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962714537 Original CRISPR CCCGCGCGGCCCGCTCACCG TGG Exonic