ID: 962715784

View in Genome Browser
Species Human (GRCh38)
Location 3:138124894-138124916
Sequence CAAATCAGCCCCAAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962715781_962715784 19 Left 962715781 3:138124852-138124874 CCAGTTTCTCTCTGCGCTGGCGT 0: 1
1: 0
2: 1
3: 14
4: 90
Right 962715784 3:138124894-138124916 CAAATCAGCCCCAAGTAGCCAGG 0: 1
1: 0
2: 1
3: 29
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962715784 Original CRISPR CAAATCAGCCCCAAGTAGCC AGG Intronic
905380389 1:37557615-37557637 AAAGTCAGCCCCCAGCAGCCTGG + Exonic
905491482 1:38347461-38347483 CAAATCAGACTCCAGAAGCCTGG + Intergenic
905535436 1:38717956-38717978 CAACACAGCCCAAACTAGCCTGG + Intergenic
906339002 1:44961563-44961585 CACTTCAGCTCCAAGTAGCTGGG - Intronic
906629124 1:47350378-47350400 TAAATTGGCCCCAAGTAGCTGGG - Intronic
907054613 1:51353688-51353710 CACCTCAGCCCCCAGTAGCTGGG + Intergenic
912544171 1:110439006-110439028 ACAATCAGCCCCAAATGGCCAGG - Intergenic
912578029 1:110693528-110693550 CACATCAGCCCCAGGAAGCCTGG - Intergenic
912761876 1:112374922-112374944 CACCTCATCCCCAAGTAGCTGGG - Intergenic
913298157 1:117342379-117342401 AAAATAAGCCCCATTTAGCCAGG - Intergenic
913377811 1:118173744-118173766 CAAGTCAGCCTCAAGTAGCTGGG - Intronic
914477773 1:148038545-148038567 AAAAGCAGCCCCAAGTAGAAAGG + Intergenic
914989043 1:152482463-152482485 TTAATCAGCACCAAGTAGCCAGG + Intergenic
919545573 1:198913897-198913919 AACATCAGCCCCAAGTGACCAGG + Intergenic
919706420 1:200680622-200680644 CACCTCAGCCCCACGTAGCTGGG - Intergenic
920708947 1:208276707-208276729 CACATCAGCCCCGACTAGGCTGG + Intergenic
922416965 1:225431026-225431048 CACCTCAGCCCCGAGTAGCTGGG + Intergenic
923238940 1:232061982-232062004 GAACTCAGCCCCCAGTGGCCTGG - Intergenic
1062901746 10:1151876-1151898 CAGATGAGACCCAAATAGCCAGG - Intergenic
1067076003 10:43182759-43182781 CATCTCAGCCCCGAGTAGCTGGG - Intronic
1067228516 10:44390815-44390837 CAAATCAGACCCAAGGCCCCAGG + Intergenic
1067407349 10:46034888-46034910 CACCTCAGCCCCAAGTAGCTGGG - Intronic
1067671925 10:48331623-48331645 TTAATCAGCACCAAGTTGCCAGG + Intronic
1068080272 10:52310743-52310765 CACCTCACCCCCAAGTAGCTGGG - Intergenic
1071352738 10:84763040-84763062 CAAGTCAGCCCCAAGTATAGTGG + Intergenic
1072633236 10:97161253-97161275 CAAATCAGCCCCTCATAGCCAGG + Intronic
1073218730 10:101852042-101852064 GAAATCAGCCCCTAGGAACCAGG + Intronic
1074268398 10:111928298-111928320 CAATTCAGCCCCAGGAAGTCTGG + Intergenic
1075145526 10:119879706-119879728 CACCTCATCCCCAAGTAGCTGGG - Intronic
1075619485 10:123915259-123915281 AAAATAAGCCCCACGTAGGCCGG + Intronic
1076246464 10:128950879-128950901 CTAATTAGCCCCCAGCAGCCGGG - Intergenic
1077199541 11:1298723-1298745 CTCATCAGCCCCACGCAGCCCGG + Intronic
1078137630 11:8664995-8665017 GAACTCAGCCCCATGTAGCGTGG + Intronic
1081483344 11:43508428-43508450 CAAGTGAGCCCCAAGAAGCCAGG + Intergenic
1082014271 11:47472666-47472688 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1083201867 11:61125556-61125578 CAATTAAGCCCCAGGGAGCCTGG + Intronic
1083734916 11:64674511-64674533 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1083974756 11:66108853-66108875 TACCTCAGCCCCAAGTAGCTAGG - Intronic
1084234119 11:67775319-67775341 GAAATCACCCTCAAGTAGCAGGG + Intergenic
1085580895 11:77649528-77649550 CACCTCAACCCCAAGTAGCCGGG + Intergenic
1090929556 11:131283348-131283370 CACCTCAGCCCCCAGTAGCCTGG - Intergenic
1092312778 12:7375980-7376002 CATATCAGCTCCAACCAGCCTGG + Exonic
1093564190 12:20582304-20582326 CACCTCAGACCCAAGTAGCTGGG + Intronic
1096909546 12:54968604-54968626 CAAAACAGCCACAATGAGCCAGG - Intronic
1097088809 12:56488765-56488787 CAAACCAGCGCCCAGTAACCCGG + Intergenic
1098009434 12:66034577-66034599 CACCTCAGCCTCAAGTAGCAGGG + Intergenic
1098486139 12:71024160-71024182 CACCTCAGCCCCAAGTAGCTAGG + Intergenic
1102207404 12:111099755-111099777 AAAATCAGACCCAGGCAGCCTGG + Intronic
1103982078 12:124743049-124743071 GAAATCAGCCCCAAATTGCCTGG + Intergenic
1106928462 13:34637567-34637589 ACAATCAGCCCCAAACAGCCAGG - Intergenic
1107348476 13:39488682-39488704 ATAATCAGCGCCTAGTAGCCAGG + Intronic
1107680325 13:42841756-42841778 CACTTTAGCCCCAAGTAGCTGGG - Intergenic
1110574730 13:77042307-77042329 CACCTCAGCCCCAAGTAGCTGGG - Intergenic
1111586671 13:90291298-90291320 TTAATCAGCACCAAGTCGCCGGG - Intergenic
1111924516 13:94448129-94448151 CATCTCAGCCTCAAGTAGCTGGG - Intronic
1113994537 14:16055388-16055410 CAAAGCAGGCCCAAGCCGCCTGG + Intergenic
1114561118 14:23591176-23591198 CAAAATAGCTCCAAGTAGGCCGG - Intergenic
1119053627 14:71395545-71395567 CACCTCAGCCCCCAGTAGCTGGG - Intronic
1119807716 14:77493109-77493131 CACTTCAGCCCCCAGTAGCTGGG + Intronic
1121402331 14:93690896-93690918 CTAATCAGCTCCGAGGAGCCAGG + Intronic
1122851471 14:104534837-104534859 ACAATCAGCCCCAAATGGCCAGG + Intronic
1123109513 14:105859256-105859278 CAACTCAGCCCAAACCAGCCTGG + Intergenic
1124035149 15:26047853-26047875 CAAATAAGCCCCAAGGAGGGAGG - Intergenic
1124596775 15:31097783-31097805 CGCAACAGCCCCAGGTAGCCAGG - Intronic
1127895340 15:63293876-63293898 CACTTCAGCCTCAAGTAGCTGGG + Intronic
1129904618 15:79177716-79177738 CAGATAAACCCCAAGAAGCCTGG + Intergenic
1130292254 15:82613499-82613521 CACCTCAGCCCCAAGTAACTGGG + Intronic
1133132056 16:3682745-3682767 CACATCAGCCCCCTGTAGCTAGG - Intronic
1133778106 16:8913862-8913884 CACCTCAGCCTCAAGTAGCTGGG + Intronic
1133996320 16:10751318-10751340 CACATCAGTCCCAAGTATCAAGG + Intronic
1134403744 16:13937033-13937055 CACATCAGCCCCAAGTGGCTGGG + Intronic
1137481071 16:48852441-48852463 CAATTCATCCCAAAATAGCCAGG + Intergenic
1137510254 16:49093367-49093389 CAAATCAAACCCAAGCAGTCTGG - Intergenic
1137932356 16:52601219-52601241 CAAATCATCCATGAGTAGCCTGG - Intergenic
1138894122 16:61182389-61182411 CAAACCAGCCCCCAGGAACCAGG - Intergenic
1140587417 16:76309625-76309647 CCTATCAGCCCCAAATAGCCAGG - Intronic
1141499377 16:84433081-84433103 AAAATCTTCCCCAAGTAGGCTGG + Intronic
1142613637 17:1123058-1123080 CAAAACATCCCCAAGTACTCAGG + Intronic
1144530648 17:16035655-16035677 CACCTCAGACCCAAGTAGCTGGG + Intronic
1146975143 17:37104824-37104846 CACCTCAGTCCCAAGTAGCTAGG - Intronic
1148357151 17:46983073-46983095 GCAATCAGCCCCAAATGGCCAGG - Intronic
1148713951 17:49702232-49702254 CACCTCAGCCCCGAGTAGCTGGG + Intronic
1149526097 17:57357040-57357062 CAAATCAGCCCCGAGAAGCGGGG - Intronic
1152837113 17:82540510-82540532 CAAACCATCCCCAAGCATCCAGG - Intronic
1153517307 18:5916148-5916170 CAAATCACACTCAAGTAGCAAGG - Intergenic
1157337895 18:46754976-46754998 CCAATCAGATCCAAGAAGCCAGG + Intronic
1157948995 18:52013142-52013164 GAAATCAGCCTCAGCTAGCCAGG - Intergenic
1158499582 18:57988145-57988167 TAAGTCAGCCCCAAATGGCCAGG - Intergenic
1158542174 18:58366926-58366948 CAAATGAGCCCCCAGGAGACTGG - Intronic
1162626455 19:11888536-11888558 AAAAACAACCCCAAGAAGCCTGG + Intronic
1163356121 19:16812324-16812346 GAAACCAGCCCCAAGGAACCAGG - Intronic
1163837567 19:19584364-19584386 CAAATCAGACACAGGTAGACAGG + Intronic
1164643032 19:29840278-29840300 CAAATCAGCCCCTAGTGTCTGGG - Intergenic
1165071965 19:33260978-33261000 GAAATCTGCCCCCAGCAGCCCGG - Intergenic
1165134980 19:33662192-33662214 CGCATCAGCCCCCAGTAGCTGGG + Intronic
1167561646 19:50229524-50229546 CACCTCAGCCTCAAGTAGCTGGG - Intronic
1167853651 19:52220869-52220891 CAAAGCAGCCCCTAGGTGCCAGG - Intronic
1168407384 19:56118026-56118048 AAAAACAGCCTCAAGTTGCCAGG + Intronic
925266643 2:2570877-2570899 CAAATCTGTCCCAGGTAGACTGG - Intergenic
927335286 2:21915704-21915726 CAAATCAGAGCCAAGGAGCTTGG + Intergenic
928329494 2:30346853-30346875 CAAACCAGCCCCACGTGGGCTGG + Intergenic
929302863 2:40325836-40325858 AATATCAGTCCCAAGTAGCTGGG - Intronic
929836767 2:45409106-45409128 CACCTCAGCCCCAAGTAGCTGGG - Intronic
933171438 2:79130242-79130264 CATATAATCCCCAAGTAGCAGGG - Intergenic
935728712 2:106046874-106046896 CACTTCAGCCCCTAGTAGCTGGG - Intergenic
935930405 2:108118002-108118024 AAGATCAGCCCCAAATGGCCAGG - Intergenic
938058952 2:128237499-128237521 ACAATCAGCCCCAAATGGCCAGG + Intronic
938536934 2:132255362-132255384 CAAAGCAGGCCCAAGCCGCCTGG - Intronic
940368234 2:152872512-152872534 CAAATCAGCCCCAAGAGATCAGG - Intergenic
940898268 2:159102391-159102413 CACCTCAGCCTCAAGTAGCTGGG + Intronic
940898525 2:159104660-159104682 CACCTCAGCCTCAAGTAGCTGGG + Intronic
942247647 2:174022709-174022731 CACCTCAGCTCCAAGTAGCTGGG - Intergenic
942383258 2:175415619-175415641 CACCTCAGCCTCAAGTAGCTGGG + Intergenic
942778409 2:179612761-179612783 AAAATCAGCCCCAGGTGGGCTGG + Intronic
947652000 2:231794866-231794888 CTACTCAGCCCCAAGTAGCTGGG + Intronic
1174225126 20:48992486-48992508 CAAATCAGACCCCAGTTGCCAGG - Intronic
1174673641 20:52332227-52332249 CAAACAAGCCCCAAATAGCAGGG + Intergenic
1175687578 20:61042877-61042899 CAAATGTGCCCCAAGTTTCCTGG - Intergenic
1177362718 21:20094211-20094233 AAAATCTGCCCCAAGTACCCTGG - Intergenic
1178420262 21:32437644-32437666 GAAATCACCCTCAAGTAGCAGGG - Intronic
1180312554 22:11252016-11252038 CAAAGCAGGCCCAAGCCGCCTGG - Intergenic
1180731359 22:17984888-17984910 CAACTCAACCCCAGGCAGCCTGG + Intronic
1180959424 22:19755912-19755934 TATATTTGCCCCAAGTAGCCTGG + Intergenic
1181516392 22:23416104-23416126 CAACTCAACCCCAGGCAGCCTGG + Intergenic
1182250592 22:28997069-28997091 CAAATCAGACCCAAGGATTCCGG - Intronic
1184733640 22:46385206-46385228 CACCTCAGCCTCAAGTAGCTGGG + Intronic
950743489 3:15068294-15068316 CACCTCAGCCCCGAGTAGCTTGG + Intergenic
952309086 3:32170856-32170878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
953951536 3:47194359-47194381 ACAATCAGCCCCAAACAGCCAGG - Intergenic
954251809 3:49373564-49373586 CATCTCAGCCCCAAGTGGCTGGG - Intronic
954685089 3:52365914-52365936 CAAATAGGGCCCAATTAGCCAGG - Intronic
954954650 3:54508461-54508483 CATATCAGCCCCATGAAGGCGGG + Intronic
956150808 3:66240401-66240423 CACCTCAGTCCCAAGTAGCTGGG + Intronic
956697913 3:71934320-71934342 GCAATCAGCCCCAAGTGGCCAGG + Intergenic
959233954 3:103693648-103693670 CAATTCAGCCCATAGTACCCAGG - Intergenic
960299373 3:115983405-115983427 CACCTCAGCCTCAAGTAGCTGGG - Intronic
960949988 3:122993008-122993030 CTCATCAGCCCCAGGAAGCCCGG - Intronic
961713484 3:128844298-128844320 CAAATCATCCCTAAGAAGGCTGG - Intergenic
961843045 3:129734567-129734589 CACCTCAGCCTCAAGTAGCTGGG - Intronic
962715784 3:138124894-138124916 CAAATCAGCCCCAAGTAGCCAGG + Intronic
968088872 3:195887168-195887190 GAAATCAACCCCAACTAACCCGG + Intronic
968860874 4:3168760-3168782 CACCTCAGCCCCGAGTAGCTGGG - Intronic
969297174 4:6277071-6277093 CAATTCAGCCCCCTGCAGCCAGG + Intronic
969821029 4:9720441-9720463 GAAATCACCCTCAAGTAGCAGGG - Intergenic
970544380 4:17112361-17112383 CAAATGAACTCGAAGTAGCCAGG + Intergenic
973955201 4:56056677-56056699 CACCTCAGCCCCAAGTAACTGGG - Intergenic
974060322 4:57027419-57027441 CATCTCAGCCTCAAGTAGCTGGG + Intronic
975365675 4:73524728-73524750 CACTTCAGCCCCAAGTGGCAAGG + Intergenic
977829306 4:101571522-101571544 AAAATCAGCCACAAATGGCCAGG + Intronic
979597159 4:122546901-122546923 CAAATCAGCCAAAAGTAGCTAGG - Intergenic
980909939 4:138985130-138985152 CATATCCTCCCCAAGTAGCTAGG + Intergenic
984978733 4:185256737-185256759 CACCTCAGCCCCAAGTAGCTGGG + Intronic
986141508 5:5034720-5034742 CACATCAGCCCCTAGTAGCTGGG - Intergenic
986649465 5:9949110-9949132 GCAACCAGCCCCAAGTGGCCAGG - Intergenic
992177537 5:74165144-74165166 CAATTCAGTACCAAGTGGCCTGG - Intergenic
992843718 5:80722989-80723011 TTCATCAGCCCCAAGTAGCTAGG - Intronic
993443154 5:87980329-87980351 CTATTCAGCCCCAGGTAGACGGG + Intergenic
995089454 5:108155548-108155570 CAATTAACCCCCAAGTAGCTAGG + Intronic
995176538 5:109184183-109184205 TATATCAGCCCCAAATACCCAGG - Intronic
996728376 5:126692862-126692884 CACCTCAGCCCCAAGTAGCTGGG + Intergenic
997156334 5:131563616-131563638 CATATCAGTCCCAAGTAGCTGGG + Intronic
997233495 5:132259507-132259529 CAGCTCAGGCCCAAGGAGCCAGG + Intronic
997679294 5:135737995-135738017 CACATCAGTCCCAAGTATCAAGG - Intergenic
999678159 5:154027824-154027846 CAAATCACACCCAAGGAACCAGG + Intronic
999802834 5:155053674-155053696 CAAATCAGCCCCAAGGAGACAGG - Intergenic
1001508466 5:172299143-172299165 CACCTCAGCACCAAGTAGCTAGG + Intergenic
1003976905 6:11353181-11353203 CAATTCAACCCCTAGCAGCCAGG - Intronic
1005437719 6:25832817-25832839 CACTTCAGCCCCAAGTAGCTGGG + Intergenic
1006205806 6:32341545-32341567 CAAATTAGCCACCACTAGCCCGG - Intronic
1008874440 6:56310235-56310257 CAAAGTAGTCCAAAGTAGCCAGG - Intronic
1010646962 6:78400968-78400990 CATCTCAGCCCCAAGTAGTGGGG - Intergenic
1011083650 6:83515615-83515637 CAACTCAGCCCAGAGTAGCTGGG + Intronic
1011338902 6:86290725-86290747 CAACTTTGCCACAAGTAGCCTGG + Intergenic
1012496520 6:99839225-99839247 CACCTCAGTCCCAAGTAGCTGGG - Intergenic
1016911143 6:149200516-149200538 ACAATCAGCCCCAAGTGCCCAGG + Intergenic
1021446248 7:20736778-20736800 CTAATCAGACCCAATTAGCTAGG - Intronic
1025619714 7:63157447-63157469 CACCTCAGCCTCAAGTAGCTGGG - Intergenic
1026320903 7:69266868-69266890 CACCTCAGCTCCAAGTAGCAGGG + Intergenic
1026437651 7:70413788-70413810 CTACTCAGCCTCAAGTAGCTGGG + Intronic
1027493086 7:78855200-78855222 CACCTCAGCCCCAAGTAGCTGGG + Intronic
1029247088 7:99209890-99209912 CACCTCAGCCTCAAGTAGCTGGG - Intergenic
1030186746 7:106769856-106769878 CACCTCAGCCCCGAGTAGCTGGG - Intergenic
1033652446 7:143353159-143353181 CAAATCAGCAGCAGGAAGCCTGG + Intergenic
1036492982 8:9244913-9244935 CAAAGCAGCCCCAGGGAGACTGG + Intergenic
1037441177 8:18917788-18917810 CCAACTAGCCCAAAGTAGCCAGG + Intronic
1037458710 8:19087782-19087804 CACAACTGCCCCAAGTAGGCAGG + Intergenic
1038917472 8:32039906-32039928 CACCTCAGCCCCAAGTAGCTTGG - Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1044665431 8:94629901-94629923 GAAATTAGGGCCAAGTAGCCAGG + Intergenic
1045179333 8:99763020-99763042 CACTTCAGCCCCAAGTAGCTGGG - Intronic
1046652840 8:116857857-116857879 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1046949428 8:120005692-120005714 CGTATCCTCCCCAAGTAGCCAGG - Intronic
1047243604 8:123117812-123117834 CATTTCAGCCACAAGTAGCTAGG - Intronic
1047491916 8:125382153-125382175 CAAAACAGCCCCACTGAGCCAGG + Intergenic
1049772641 8:144390862-144390884 GACATCACCTCCAAGTAGCCTGG - Exonic
1059209050 9:112494581-112494603 CAGTTTAGCCCCAAGTAGCTGGG + Intronic
1059314433 9:113411790-113411812 CACCTCAGCCCCAAATAGCTGGG + Intronic
1059795593 9:117693117-117693139 CAAATCAGCCCCATGCAAACAGG - Intergenic
1061208258 9:129176724-129176746 CAGCTCAGCCCCGAGTGGCCCGG + Exonic
1187525592 X:20051434-20051456 CACTTCAGCCTCAAGTAGCTGGG - Intronic
1192016958 X:67341455-67341477 CAAATTAGCCCCAAGTGCCTTGG - Intergenic
1192119035 X:68437657-68437679 CACTTCAGTCCCAAGTAGCTGGG + Intergenic
1193565205 X:83067300-83067322 CAAATCAGCCACAAATTGCCAGG + Intergenic
1193971654 X:88062851-88062873 CAAATCAGCTCCGAGTGGCAAGG + Intergenic