ID: 962718899

View in Genome Browser
Species Human (GRCh38)
Location 3:138153920-138153942
Sequence TAATCCCCACGCATAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962718899_962718907 11 Left 962718899 3:138153920-138153942 CCTCCCTCTATGCGTGGGGATTA No data
Right 962718907 3:138153954-138153976 ATTTAAGATGAGATTTGGGTAGG 0: 327
1: 8805
2: 12549
3: 10823
4: 7586
962718899_962718908 12 Left 962718899 3:138153920-138153942 CCTCCCTCTATGCGTGGGGATTA No data
Right 962718908 3:138153955-138153977 TTTAAGATGAGATTTGGGTAGGG 0: 27
1: 974
2: 9945
3: 13736
4: 10626
962718899_962718905 6 Left 962718899 3:138153920-138153942 CCTCCCTCTATGCGTGGGGATTA No data
Right 962718905 3:138153949-138153971 TTACAATTTAAGATGAGATTTGG 0: 115
1: 3421
2: 12075
3: 13232
4: 10798
962718899_962718906 7 Left 962718899 3:138153920-138153942 CCTCCCTCTATGCGTGGGGATTA No data
Right 962718906 3:138153950-138153972 TACAATTTAAGATGAGATTTGGG 0: 300
1: 8167
2: 12277
3: 9799
4: 7070

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962718899 Original CRISPR TAATCCCCACGCATAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr