ID: 962720962

View in Genome Browser
Species Human (GRCh38)
Location 3:138174564-138174586
Sequence CCGGGCCCGGACTTGGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962720962_962720975 21 Left 962720962 3:138174564-138174586 CCCACCGCCAAGTCCGGGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 962720975 3:138174608-138174630 GTTTGCATGTGACGATACTTGGG 0: 1
1: 0
2: 0
3: 3
4: 84
962720962_962720977 29 Left 962720962 3:138174564-138174586 CCCACCGCCAAGTCCGGGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 962720977 3:138174616-138174638 GTGACGATACTTGGGCGGCACGG 0: 1
1: 0
2: 0
3: 1
4: 39
962720962_962720970 -1 Left 962720962 3:138174564-138174586 CCCACCGCCAAGTCCGGGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 962720970 3:138174586-138174608 GCCGCGTCCTCACCTGTAGAAGG 0: 1
1: 0
2: 0
3: 7
4: 102
962720962_962720976 24 Left 962720962 3:138174564-138174586 CCCACCGCCAAGTCCGGGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 962720976 3:138174611-138174633 TGCATGTGACGATACTTGGGCGG 0: 1
1: 0
2: 1
3: 5
4: 47
962720962_962720974 20 Left 962720962 3:138174564-138174586 CCCACCGCCAAGTCCGGGCCCGG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 962720974 3:138174607-138174629 GGTTTGCATGTGACGATACTTGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962720962 Original CRISPR CCGGGCCCGGACTTGGCGGT GGG (reversed) Intronic
900401717 1:2475464-2475486 CCCGGCCTGGACTTGGGGATGGG + Intronic
902600912 1:17539763-17539785 GCGGGCCCGGACCTCGCGGGCGG + Intergenic
903349981 1:22711405-22711427 GCGGGCCCGGCCGTGGCGGGGGG + Intronic
904194544 1:28775313-28775335 CGGGGGCCGGGCTTGGCGGCTGG + Intergenic
923338051 1:232986708-232986730 CAGGACCTGGACTTGGCGGGAGG - Intronic
1075048593 10:119165525-119165547 CCCGGGCCGTACTTGGCGCTCGG + Exonic
1077514254 11:2992182-2992204 CCGGGCCCGGACGGGCGGGTGGG - Intronic
1078246135 11:9574231-9574253 CCGGGCGCGGACGAGGCGGGCGG + Exonic
1083782286 11:64924830-64924852 CCGGGCCGGGACTGGGCGCTCGG - Exonic
1086454282 11:86946182-86946204 TGGGGCCCTGACTTGGCTGTGGG - Exonic
1095440900 12:42238114-42238136 CGGGGCCCGGACTGTGCGGGCGG - Intronic
1095497225 12:42797885-42797907 CCGCGCCCGGCCTTGTCAGTGGG - Intergenic
1101904587 12:108815178-108815200 CCGGGCTGGGACTTGGAGGCAGG - Intronic
1102441073 12:112964299-112964321 CTGGGCCAGGAACTGGCGGTTGG - Exonic
1102569852 12:113820809-113820831 CCTGGCCTGGAATTGGCAGTGGG - Intronic
1103721720 12:122978897-122978919 CCGGGCCAGGACCTGGAGCTGGG + Exonic
1121312650 14:92943510-92943532 CCGGGCACGGGCATGGCTGTTGG + Intronic
1125534887 15:40437136-40437158 ACGGCCCCGGCCTTGGGGGTGGG - Intergenic
1127426672 15:58865099-58865121 CCGGGCCCGCACGAGGCGCTGGG + Intergenic
1127994793 15:64147196-64147218 CTGGGCCCGGGCTGGGCGGGCGG - Intergenic
1128743946 15:70100754-70100776 CCGGGCTCGGCCCTGGCGCTGGG - Intergenic
1132553175 16:561487-561509 CCCGGCCTGGACTGGGTGGTGGG - Intronic
1132648032 16:1007991-1008013 CCGGGCCCAGGCTTCCCGGTTGG + Intergenic
1132662926 16:1069597-1069619 CCGGGCCTGCACTTGGGGGAAGG - Intergenic
1134692436 16:16199730-16199752 CCGGGCCTGGAGTTTGAGGTGGG + Intronic
1136551266 16:30983789-30983811 CCGGGGCAGGAGTTGGGGGTCGG + Intronic
1137988460 16:53130454-53130476 CCGGGGCCTGACGTGGCGGCGGG + Intronic
1142692826 17:1617142-1617164 CAGGGCCCAGCCTTGGCTGTGGG + Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1150915119 17:69429059-69429081 CAGGGACAGGACTTGGTGGTTGG + Intronic
1151767904 17:76141458-76141480 CCGAGCCGGGACTTAGCGGCGGG - Intergenic
1152694164 17:81735382-81735404 CCTGACCCGGACTCGGGGGTGGG - Intergenic
1156275664 18:35581312-35581334 GGGGGCCGGGACTGGGCGGTCGG + Intronic
1157464191 18:47930517-47930539 CCGGGCCCGGGCCTGGGGGCGGG - Exonic
1160567810 18:79798067-79798089 CCGGGGCCGCAGTGGGCGGTGGG + Intergenic
1160989722 19:1855545-1855567 CGAGGCCCGGCCTTGGCGGTGGG - Intronic
1161338741 19:3729118-3729140 CAGGGCTCGGACTTGGCAGTAGG + Intronic
1161905394 19:7152707-7152729 CCAGGTCAGGACTTGGCGCTGGG - Exonic
1162523950 19:11197025-11197047 CTGGGCCTGGGCTTGGCGGCTGG - Intronic
1162940500 19:14006191-14006213 CCGGGCCGGGCCTGGGGGGTGGG + Exonic
1163313406 19:16527279-16527301 CCTGGCCAGCACTTGGAGGTGGG + Intronic
1167378999 19:49127928-49127950 CTGGGCCCGGACGAGGCGGGCGG + Exonic
937392074 2:121497866-121497888 CTGGGCCCGGGCGTGGTGGTGGG - Intronic
948190527 2:236054851-236054873 CCGGGCCCGGCAGTGGCGGCAGG - Intronic
948983927 2:241508651-241508673 CCGGGCCCGGAGTGGGCGGTGGG - Exonic
1172765768 20:37349975-37349997 CAGGGCCAGGCCTTGGCTGTAGG + Intronic
1175980787 20:62737676-62737698 CCGGGGCTGGACCTGGCGATGGG - Intronic
1176952618 21:15064801-15064823 CCGGGCCAGGACGGGGCGGCAGG - Exonic
1179810461 21:43865915-43865937 CGGGGCCCGGGGTTGGCTGTGGG + Intronic
1181981376 22:26769237-26769259 CCGGGCCCGGCTCTGGCTGTGGG - Intergenic
1183780461 22:39995593-39995615 CCGGGCCCTGCCTGGGAGGTGGG - Intronic
1183994225 22:41620949-41620971 CCGGGCCCGGGCTGAGGGGTGGG + Exonic
1184650972 22:45919345-45919367 CGGAGCCAGGACTTGGTGGTCGG - Intergenic
1184875207 22:47269990-47270012 CTGGGCCCGGTGTTGGAGGTGGG + Intergenic
954422871 3:50427807-50427829 CCAGGCCAGGCCTTGGCAGTAGG + Intronic
962720962 3:138174564-138174586 CCGGGCCCGGACTTGGCGGTGGG - Intronic
968457132 4:705651-705673 TCGGGCCTGGACTCGGCGGAGGG - Intergenic
968542551 4:1175446-1175468 TGGGGCCCCCACTTGGCGGTGGG + Intronic
987050298 5:14143187-14143209 CCGAGCCTGGGCTCGGCGGTGGG - Intergenic
989043050 5:37249064-37249086 ACGGGCCCGGACTGGGTAGTGGG + Intronic
992105743 5:73448073-73448095 CCGGGCCCGGCCCCGGCGGCGGG - Exonic
996504849 5:124257510-124257532 CCTGGCCAGGACTTGGGGGAAGG - Intergenic
997253624 5:132410676-132410698 CCGGGCCCGGGCTGGGCGGGAGG - Intronic
999240362 5:150124189-150124211 CGGGGCCTGGCCTTGGTGGTGGG + Intronic
999300215 5:150486173-150486195 CCGGGCCGGGACTGGGGGCTGGG + Intronic
1002505400 5:179675866-179675888 CAGGGCCCGCACTGGGCTGTGGG + Intergenic
1002926948 6:1610354-1610376 CCGGACTCGGACTCGGCGGCCGG + Exonic
1006170219 6:32087928-32087950 CGGGGCCGGGACTTGGGGGGCGG + Intronic
1017725683 6:157274741-157274763 CCGGTCCCGGACGGGGCGGGAGG + Intergenic
1018046292 6:159969220-159969242 CCGGGCCCGGACTGCGCGGCGGG - Exonic
1024259440 7:47562985-47563007 CTGGGCCCGGAGCTGGGGGTGGG - Intronic
1029110622 7:98211545-98211567 CAGGGGCAGGACCTGGCGGTGGG + Intronic
1029544208 7:101201905-101201927 CCTGGGCCGGACTGGGCGGGGGG + Intergenic
1029599211 7:101553910-101553932 CAGGGCACGGGCTTGGCTGTGGG + Intronic
1031604109 7:123748553-123748575 ACGGGCCCGGGCTTGGGGGCCGG - Intronic
1032693884 7:134316729-134316751 ATGCGCCCGGCCTTGGCGGTGGG - Exonic
1034680724 7:152925612-152925634 CCTGGCCCGGCCTTGGCGAAGGG - Intergenic
1035168828 7:157006729-157006751 CAGGGCCAGGCCTTGGCGCTGGG - Intronic
1042829316 8:73009223-73009245 CCGGGCCGGGACTACGCGGGGGG + Intronic
1044306366 8:90645634-90645656 CCGGGCGGGGCCTTGGCGGGCGG - Exonic
1053372720 9:37576226-37576248 CGCGGCCCGGACTCCGCGGTGGG - Exonic
1056170667 9:83981081-83981103 CCGGGCCCGGCCTTGACTGACGG - Intronic
1059102636 9:111484396-111484418 CCGGGCTCGGAGTCGGCGGGAGG + Exonic
1061045172 9:128160821-128160843 CCGGGCCGGGACGTGGAGTTGGG + Intronic
1061415409 9:130444744-130444766 CCAGGCCCGGACCTGGTGGGAGG + Intergenic
1061878018 9:133554582-133554604 CCGGGCCTGGACATGGAGCTGGG + Exonic
1062338343 9:136082312-136082334 CAGAGCCCGGACTTGGCCTTGGG - Intronic
1062630075 9:137459450-137459472 CCGGGCCCGGACGTCACGGTGGG - Intergenic