ID: 962722397

View in Genome Browser
Species Human (GRCh38)
Location 3:138187802-138187824
Sequence TCCGGGAGCTCCCGCCGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962722393_962722397 -6 Left 962722393 3:138187785-138187807 CCAAAGACGTTTCCAACTCCGGG 0: 1
1: 0
2: 0
3: 1
4: 46
Right 962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG 0: 1
1: 0
2: 1
3: 9
4: 65
962722391_962722397 -1 Left 962722391 3:138187780-138187802 CCGAGCCAAAGACGTTTCCAACT 0: 1
1: 0
2: 0
3: 10
4: 84
Right 962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG 0: 1
1: 0
2: 1
3: 9
4: 65
962722390_962722397 5 Left 962722390 3:138187774-138187796 CCGCGGCCGAGCCAAAGACGTTT 0: 1
1: 0
2: 0
3: 3
4: 39
Right 962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG 0: 1
1: 0
2: 1
3: 9
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962722397 Original CRISPR TCCGGGAGCTCCCGCCGGTG CGG Intronic
900933721 1:5752565-5752587 TCAGGGTGCTCCCGCAGGTCAGG - Intergenic
902482544 1:16719328-16719350 TCTGGGAGCTCCCCCGGGTGGGG - Intergenic
902570216 1:17342287-17342309 TCGGGGAGCTCCTGCAGGGGAGG - Exonic
904781365 1:32951495-32951517 TGCTGGAGCTCCCACCGGTGAGG + Intronic
906376892 1:45303591-45303613 TCCGGAAGCTCCCGCCTTTCTGG - Intronic
914902189 1:151716712-151716734 GCCGGCTGCTCCCGCCGCTGGGG + Exonic
915024297 1:152812744-152812766 TCCGGGGGCTCCAGCTGCTGTGG + Exonic
916749768 1:167713767-167713789 TGCGGGGTCTCCCGCCGGTGTGG - Intergenic
920066371 1:203272698-203272720 TCGGGGAGCTCCCACCCCTGGGG - Intronic
1063137563 10:3230441-3230463 GCCAGGAGCTCCTGCTGGTGAGG - Intergenic
1071506232 10:86233520-86233542 TCCGGCAGCTCCCCTGGGTGAGG - Intronic
1075069107 10:119308975-119308997 TCTGGGAGCTCCCTCCAGTGAGG + Intronic
1076500065 10:130930100-130930122 CCCGGCAGCTCCAGCAGGTGCGG + Intergenic
1076878171 10:133227046-133227068 ACGGGGAGCTCCTGCAGGTGGGG + Intergenic
1081011060 11:37812638-37812660 TCCGGGTGCTCACTCCAGTGTGG - Intergenic
1083856158 11:65394079-65394101 ACCTGGAGCTCCCGCCGCTTTGG - Exonic
1085353521 11:75815697-75815719 TCCGGGATCTCCCGGAGGTTCGG - Intronic
1094025843 12:25958974-25958996 GCCGGGGCCTCCAGCCGGTGCGG + Intergenic
1102453036 12:113055808-113055830 TCCGGGAACTCCAGCCTGGGTGG - Intergenic
1103363833 12:120368801-120368823 CCCGGGAGCGCCCGCCGGTCCGG - Intronic
1104093286 12:125533673-125533695 TCCAGGAGCCTCCGCCGGGGAGG - Intronic
1110497888 13:76190370-76190392 TGCAGGAGCTCACGGCGGTGGGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1121632023 14:95428219-95428241 TTGGGGAGCTCCAGCCTGTGTGG - Intronic
1124233502 15:27967171-27967193 TCAGGGAGCTGCTGCCTGTGCGG - Intronic
1132043090 15:98541660-98541682 TACGTGTGCTCCCGCCGTTGTGG - Intergenic
1132688899 16:1173667-1173689 TCCGGGAACGCCCGTCGGAGGGG + Intronic
1135570340 16:23544547-23544569 TTCAGGAGCTCCAGCCGCTGGGG + Exonic
1138179738 16:54933225-54933247 CCGGGGAGGGCCCGCCGGTGCGG - Exonic
1141083848 16:81077325-81077347 TCCGGGCGCTGCCGCCGGAAGGG + Intergenic
1142204840 16:88778005-88778027 TCCGGGAGCTCCTGCGGGCCTGG + Intronic
1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG + Intronic
1144828879 17:18121033-18121055 TTCAGGGGCTCCCGCCGGAGAGG + Exonic
1149849602 17:60026918-60026940 TCCCGGAGCGTCCGCCGGTCGGG - Intergenic
1149860566 17:60119606-60119628 TCCCGGAGCGTCCGCCGGTCGGG + Intergenic
1159511343 18:69401093-69401115 TCCCCGAGCTCCCGCCGGTGGGG - Exonic
1163266367 19:16224834-16224856 TCCTGGAGCCCCGGCCAGTGAGG + Intronic
1165908998 19:39212428-39212450 TCCAGGAGCCCCTGCGGGTGGGG + Intergenic
1168072747 19:53962020-53962042 TCCGCGAGCCCCCTCCGGTCTGG - Intergenic
1168538457 19:57191445-57191467 TCCGACGGCTCACGCCGGTGGGG + Intergenic
930110926 2:47677950-47677972 TCCGGGAGCTCCAGCAGGGAAGG - Intergenic
932702810 2:74002733-74002755 TCCGTGCGCTCCCTCCGGCGGGG + Intronic
932718421 2:74120339-74120361 TCCGGAAGCTCCTGCCGGGCTGG - Intergenic
934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG + Intronic
941112285 2:161428139-161428161 TCCGGGAGCTCGCCCGGGTGCGG + Intronic
948836196 2:240627091-240627113 TCAGGGAGCTCCCGCTGCCGGGG - Intronic
948991958 2:241559839-241559861 TCCGGGAGCACCCGCCTGGGTGG - Intronic
1171958243 20:31475689-31475711 GACGGGAGCTGCCGCCGGTCAGG - Intronic
1178488594 21:33033805-33033827 GCCGGGGTCTCCAGCCGGTGGGG - Intergenic
1179885086 21:44310420-44310442 CCCAGGAGCTCCCTCGGGTGGGG + Intronic
1179891845 21:44339209-44339231 GCCGGGGGCGCCCGCCGGTCGGG - Exonic
1182511435 22:30822870-30822892 GCCGGGAGCGCACGCCGGCGGGG - Intronic
1182567614 22:31212080-31212102 TCGAGGTGCTCCCGCCGGTAAGG - Intergenic
951907782 3:27721536-27721558 TCCGCAAGATCCCGCCGCTGCGG + Exonic
954392195 3:50273697-50273719 TCCGGGAGCCCCCGCCGCAGCGG + Intronic
959682821 3:109115770-109115792 TCCTGGAGCTCAAGCTGGTGGGG + Intronic
961384795 3:126517452-126517474 TCCAGGGGCTCCAGCCTGTGCGG - Intronic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
966849494 3:184155820-184155842 TCCGGGAGCCCCGGCCGCTCTGG + Intronic
968950405 4:3688543-3688565 ACAGGGAGCACCCACCGGTGGGG + Intergenic
969253028 4:5982446-5982468 TCCAGGAGCTCAGGCGGGTGTGG + Intronic
969603371 4:8189812-8189834 GCGGGGAGCTCACGCCGGCGGGG - Intronic
991157672 5:63458444-63458466 TCCAGGAGCTCCATCCAGTGGGG - Intergenic
997721641 5:136082622-136082644 TCCAGGTGCTCCCCCTGGTGGGG + Intergenic
1001533232 5:172479550-172479572 GCCGGGAGCCCCCGCAGATGCGG + Intergenic
1002277704 5:178114220-178114242 TCCGGGACCTCCCGCAGCTTTGG + Intronic
1002540242 5:179902105-179902127 GCCGGGAGCTTCCGAGGGTGAGG - Intronic
1003212344 6:4079131-4079153 GCCGGGAGACCCGGCCGGTGGGG - Exonic
1010032852 6:71288683-71288705 GGCGGCAGCTCCCGCCTGTGGGG + Intergenic
1012393494 6:98769731-98769753 CCCTGGAGCTCCCCCAGGTGGGG - Intergenic
1018818123 6:167351080-167351102 TCCGGGAGCGCAGGCGGGTGGGG + Intronic
1019628690 7:2035028-2035050 TCCCTGAGCTCCCGCCTCTGTGG - Intronic
1020089897 7:5333128-5333150 GCGGGGAGGTCCCGCCGGGGAGG - Intronic
1034433271 7:151051352-151051374 GCCGGGGGCTCCCGACGGGGCGG + Intronic
1057313216 9:93954417-93954439 CCCGGGAGCTCCAGCGGGCGAGG - Intronic
1060521852 9:124298485-124298507 TCCGGGGGCTCCTGCCCCTGGGG + Intronic