ID: 962722434

View in Genome Browser
Species Human (GRCh38)
Location 3:138187961-138187983
Sequence TGCAAGCCCGGCGCTTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962722434_962722440 15 Left 962722434 3:138187961-138187983 CCTTGTGAAGCGCCGGGCTTGCA 0: 1
1: 0
2: 0
3: 6
4: 66
Right 962722440 3:138187999-138188021 AGCGCCCACTCAGCTCTCCCGGG 0: 1
1: 0
2: 0
3: 16
4: 165
962722434_962722443 21 Left 962722434 3:138187961-138187983 CCTTGTGAAGCGCCGGGCTTGCA 0: 1
1: 0
2: 0
3: 6
4: 66
Right 962722443 3:138188005-138188027 CACTCAGCTCTCCCGGGCTTTGG 0: 1
1: 0
2: 1
3: 15
4: 168
962722434_962722439 14 Left 962722434 3:138187961-138187983 CCTTGTGAAGCGCCGGGCTTGCA 0: 1
1: 0
2: 0
3: 6
4: 66
Right 962722439 3:138187998-138188020 GAGCGCCCACTCAGCTCTCCCGG 0: 1
1: 0
2: 0
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962722434 Original CRISPR TGCAAGCCCGGCGCTTCACA AGG (reversed) Intronic
902731798 1:18374599-18374621 TGCAAGCCCTGCTCTTCCCACGG + Intronic
904340628 1:29831980-29832002 TGTTACCCCGGAGCTTCACATGG - Intergenic
909663762 1:78111368-78111390 TGTAAGCCCAGCCCCTCACAGGG - Intronic
910891776 1:92026625-92026647 TGCAATCCCGGCACTTCAGGAGG + Intergenic
914081276 1:144413351-144413373 TGCAATCCCAGCACTTCAGAAGG - Intergenic
920723244 1:208409875-208409897 TGCAAGCCAGGCACTTTAAATGG - Intergenic
1064770730 10:18719697-18719719 TGCAATCCCAGCGCTTCAGGAGG - Intergenic
1071462727 10:85913941-85913963 TGCCAGCCCGGCAGTGCACATGG - Intronic
1072875833 10:99172370-99172392 TGAAAGCCTGGTTCTTCACAAGG - Intronic
1073124923 10:101143193-101143215 TGGAAGCCAGGCGCCTCACGGGG - Intergenic
1075702422 10:124478105-124478127 TGCAAGCCCGGGGCTTGGGAGGG - Intronic
1075742693 10:124705495-124705517 TACAAGCCCTGGGCTTCCCATGG + Intronic
1081743106 11:45454632-45454654 TGCAAGCAAGGCCCTTCACACGG + Intergenic
1091281580 11:134384567-134384589 TGCTAGCCCAGCCCTGCACAGGG - Intronic
1091612154 12:2020214-2020236 TACAAGCAAAGCGCTTCACATGG - Intronic
1096594110 12:52683716-52683738 TCCAAGCCCGCCGCATCACATGG + Intergenic
1098819319 12:75208585-75208607 TGGAATCCGGGCTCTTCACAGGG - Intronic
1101923307 12:108950639-108950661 TGCAATCCCAGCACTTCAGAAGG - Intronic
1117279188 14:54220599-54220621 TGCAATCCCGGGGCTTCGCTGGG + Intergenic
1122154492 14:99742132-99742154 GGCAGGCCCAGCCCTTCACAGGG - Intronic
1122375381 14:101253553-101253575 TGCAAGCCAGGCCCTGGACATGG + Intergenic
1122894306 14:104748500-104748522 TGGAAGGCAGGCGTTTCACAGGG + Intergenic
1127444188 15:59043411-59043433 TGCAAGCCCAGCACTTTGCAAGG - Intronic
1127844188 15:62855386-62855408 TGCAAGCCCAGCACTTCAAGAGG + Intergenic
1135763320 16:25155312-25155334 TGTAATCCCAGTGCTTCACAAGG + Intronic
1141148638 16:81549316-81549338 TGCAAGCCCGGCATTTTCCAGGG - Intronic
1142517177 17:439792-439814 TATAATCCCAGCGCTTCACAAGG - Intergenic
1151682444 17:75629181-75629203 TGCTAGCCCGGCCCTTGGCAAGG + Exonic
1152680032 17:81662740-81662762 TGCAATCCCAGCACTTTACAGGG + Intronic
1161293545 19:3507983-3508005 GGCAAGCCCGGTGCTTTACTGGG + Intronic
1165572428 19:36786522-36786544 TGTAATCCTAGCGCTTCACAAGG - Intergenic
1167032774 19:46974533-46974555 TGCAAGGGCGGCGATTCACCAGG + Intronic
1167538341 19:50069699-50069721 TGTAAGCCCAGCGCTTTTCAAGG + Intergenic
926428272 2:12759657-12759679 TGCAAGTCCTTCTCTTCACAGGG - Intergenic
926718034 2:15940284-15940306 TGCAAGCCCGGGGGTCCAAAAGG + Intergenic
934926904 2:98388527-98388549 TGCAAGATGGGGGCTTCACATGG - Intronic
935693086 2:105747065-105747087 AGCAAGCCCGACGGTTAACAGGG - Intronic
943550288 2:189330417-189330439 TGAAAGCCCGGAGGTTCACAGGG + Intergenic
945573745 2:211503851-211503873 TGCAAGCACTGGCCTTCACAGGG - Intronic
948699466 2:239751043-239751065 TGCAGGCCCGGCTCTCCACAAGG + Intergenic
1173449665 20:43151603-43151625 TGCAATCCCAGCACTTCAGAAGG + Intronic
1175202263 20:57286111-57286133 TGGAAGCCAGGCTCTTCATATGG - Intergenic
1176011068 20:62895929-62895951 TACAAGCCAGTCGCTTCACTGGG - Intronic
1183243622 22:36676562-36676584 TCCAAGCCCTGGGCTTCGCAGGG - Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1183734275 22:39635363-39635385 TCCCAGCCCTGCGCTTCTCAAGG - Intronic
1184070312 22:42142945-42142967 TCCAACCCTGGCGCTCCACAAGG + Intergenic
1184105554 22:42365677-42365699 TGCAAGCCTGAGACTTCACAGGG + Intergenic
952357270 3:32596182-32596204 TGTAACCCCAGCTCTTCACAGGG - Intergenic
956789609 3:72670493-72670515 TGTAATCCCCGCGCTTTACAAGG - Intergenic
959325983 3:104937179-104937201 TCCAAGCCAGGCGCATCACGAGG - Intergenic
962722434 3:138187961-138187983 TGCAAGCCCGGCGCTTCACAAGG - Intronic
963052598 3:141154708-141154730 TGTAATCCCGGCACTTTACAAGG + Intergenic
964711074 3:159672384-159672406 TGCAAGGCAGTCTCTTCACATGG + Intronic
966206793 3:177413395-177413417 TGCAATCCCGGCACTTCAGGAGG + Intergenic
969207737 4:5660276-5660298 TCCAAGCCTGGCTCTTCACCAGG + Intronic
985851397 5:2391293-2391315 GGCTAGGCCGGGGCTTCACAGGG + Intergenic
986130902 5:4929105-4929127 TGCAAGGCAGGCTCTTCACAAGG + Intergenic
987999355 5:25330125-25330147 TGCAAGCCCGGCTCTGCCCCAGG - Intergenic
991180997 5:63751027-63751049 TACAAGCCTGGAGTTTCACAGGG + Intergenic
992600295 5:78391746-78391768 TGCAATCCCGGCACCTCAGAAGG + Intronic
997413863 5:133710288-133710310 TACAAGCCCGGCCCTCCACCAGG + Intergenic
1019427025 7:982761-982783 TGCAAACCCTGAGCTCCACAGGG + Intergenic
1023601364 7:41884675-41884697 TGCAAGCCCAGCCCTTCCCTGGG + Intergenic
1028193595 7:87879203-87879225 TGCAATCCCAGCGCTTTAGAAGG - Intronic
1035270045 7:157714380-157714402 CGCAAGCCCAGCCCTGCACAGGG - Intronic
1035734278 8:1876421-1876443 AGCAAGCCCGGGGCTCCGCAGGG + Intronic
1045507650 8:102789832-102789854 TGCAAGCCCAGCACTTCAGGAGG + Intergenic
1057879479 9:98782273-98782295 TCCAAGTCCAGCGCTTCACTGGG + Intronic
1061036554 9:128117598-128117620 TGTAAGCCCGGCACTTCAGGAGG - Intergenic
1186618608 X:11214925-11214947 GGGCAGCCCGGTGCTTCACACGG - Intronic
1195021215 X:100830826-100830848 TGCAGGCCCGGCGGGTCCCACGG - Intronic
1197587321 X:128364379-128364401 TCCAAGCCCAGCGCAGCACAAGG + Intergenic