ID: 962723753

View in Genome Browser
Species Human (GRCh38)
Location 3:138201409-138201431
Sequence GGGAAGAAGACAAGGACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 326}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962723753 Original CRISPR GGGAAGAAGACAAGGACTCT AGG (reversed) Intronic
900343050 1:2197622-2197644 GGGCAGAAGGCAGGGCCTCTGGG + Intronic
901099558 1:6708857-6708879 GGCAAGAAAACAAGGCCACTGGG - Intergenic
901359730 1:8686775-8686797 GTGATGAAGACAAGTACTCTAGG + Intronic
901779492 1:11584092-11584114 GGAAACAAGACAAGGACACTAGG - Intergenic
902438335 1:16412398-16412420 GAAAAGAATAAAAGGACTCTAGG - Intronic
904163246 1:28536528-28536550 TGGAAGAACACCAGGACTCTAGG - Intronic
904283507 1:29438056-29438078 TGGAAGAATGCAAGGCCTCTTGG - Intergenic
905521802 1:38605936-38605958 TGGCACAAGACAAGGTCTCTTGG + Intergenic
906057754 1:42929819-42929841 GGGAAGAAGGCCAGGGCTCAGGG + Intronic
906179335 1:43804891-43804913 TGGAGGAAGACAAAGACTCCAGG + Intronic
907584170 1:55601405-55601427 GAGAAAAAGACATGAACTCTTGG + Intergenic
911044791 1:93619452-93619474 GTGTAGAAGAAAAGGAATCTTGG - Intronic
911429203 1:97761974-97761996 GGAAGGAACACAAGGACACTAGG + Intronic
911730820 1:101290803-101290825 AGGAAGCAGAGAAGGAATCTGGG - Intergenic
912624107 1:111193645-111193667 GGGAAGAAGAAAAGGATGTTAGG - Intronic
912626915 1:111213021-111213043 GGGAAGAGGAAAAGAACTGTGGG - Intronic
914803608 1:150976961-150976983 GTGTAGCAGATAAGGACTCTGGG - Intergenic
915275861 1:154787743-154787765 TGGAGGCAGACAAGGCCTCTTGG - Intronic
915543604 1:156583514-156583536 GGGGAGAAGACAAGGAGTGAAGG - Intronic
917172035 1:172187447-172187469 GGGAAGAAAAGAAGGGCTCAGGG - Intronic
917535604 1:175872234-175872256 GGGAAGAAGACAAGGCATGGTGG + Intergenic
917654506 1:177112792-177112814 GGGAAACAGAGAAGGATTCTGGG - Intronic
919564956 1:199172981-199173003 GGGATGAATACAAGGAGTCAGGG + Intergenic
921099146 1:211913084-211913106 GGGAGGAAGAGAAGGAGACTTGG - Intergenic
921441598 1:215193323-215193345 GGGCAGAAGATAAGGATTTTAGG - Intronic
922481559 1:225943018-225943040 TGGAGGAGGACAAGGACCCTGGG + Intergenic
922950403 1:229554276-229554298 AGGAAGAAGCCAGGGACTCCAGG + Intronic
923216752 1:231855630-231855652 GGAGAGAACATAAGGACTCTTGG - Intronic
924593002 1:245421296-245421318 TTGGAGAAGAGAAGGACTCTGGG + Intronic
1063013563 10:2050948-2050970 AGAAAGAAGACAAGAAGTCTTGG - Intergenic
1063309103 10:4936249-4936271 GGGAAGAATCTAAGGACTATGGG + Intronic
1063624964 10:7680141-7680163 GTGTATAAGCCAAGGACTCTGGG + Intergenic
1067957213 10:50805474-50805496 GAGAAGAGGCCTAGGACTCTGGG + Exonic
1067980665 10:51080755-51080777 AGGAAGCAGACAAGGGCTGTCGG - Intronic
1069227687 10:65964184-65964206 AGGAACAAGACAAGAACTCAGGG + Intronic
1069641170 10:69956403-69956425 GGCAAGAAGACAAGGGTTCCTGG - Intronic
1069917493 10:71796343-71796365 GGGGAGCAGGCAGGGACTCTGGG + Intronic
1070669154 10:78365957-78365979 GGGAAGTACACAAGATCTCTGGG - Intergenic
1074223367 10:111460180-111460202 AGAAAGAGGACAAGGAGTCTGGG - Intergenic
1078143600 11:8708589-8708611 GGAAAGAAAACAAAGACACTGGG + Intronic
1078522893 11:12077570-12077592 GGGAGGAAGAGAAGGATTCGAGG - Intergenic
1078604659 11:12764617-12764639 GGGAAAAAGAAAAGGACCCCTGG + Intronic
1078804961 11:14689639-14689661 AGGAGAAAGACAAGGACTGTGGG + Intronic
1078858736 11:15227907-15227929 GGCAATAAGACAAGGAATTTTGG + Intronic
1079006994 11:16798468-16798490 GGGAAAAAAAAAAGGATTCTAGG + Intronic
1079043163 11:17077556-17077578 GGGAGGAAGACAGGGAGTGTGGG - Intronic
1079649035 11:22903380-22903402 AGGAAGAACATAAGGCCTCTAGG + Intergenic
1079853985 11:25576916-25576938 GGGAAGAAGGGAATGAGTCTGGG + Intergenic
1080240099 11:30117845-30117867 AGGGAGAATACAAGTACTCTAGG + Intergenic
1080583181 11:33659969-33659991 GGGAAGCAGAGGAGGACTCTGGG - Intronic
1081330366 11:41793262-41793284 GGGACTAAGACAAAGCCTCTCGG + Intergenic
1082802483 11:57425161-57425183 GGGATGAGGACAAGGATCCTTGG + Intronic
1083969279 11:66063547-66063569 GGGAAGCAGAGAATGCCTCTTGG + Intronic
1084148156 11:67275825-67275847 GGGAAGGAGAGGAGGCCTCTGGG - Intronic
1087575711 11:99986488-99986510 GGTAAGAAGAGATGGAGTCTAGG - Intronic
1088559869 11:111103298-111103320 GAGAAGAAGTCAAGGTGTCTTGG - Intergenic
1088666545 11:112099373-112099395 AAGAAGAAGACTAGAACTCTGGG - Intronic
1089523062 11:119078506-119078528 GGGAAAATCACAAGGTCTCTTGG - Intronic
1089606563 11:119644833-119644855 GGGAGAAAGACAAGGAATCAGGG + Intronic
1089957469 11:122584995-122585017 GGGAAGAAGCCAAGGACAATAGG - Intergenic
1090511024 11:127375267-127375289 AGGAGGAAGAGAAGGACACTAGG - Intergenic
1091642634 12:2249083-2249105 GGTAAGGAGGTAAGGACTCTGGG + Intronic
1092042336 12:5395741-5395763 GGGAAGGAGACCAGGAGTCAGGG - Intergenic
1094190127 12:27689673-27689695 AGGGAGAAGGCAAGGACTCAAGG - Intronic
1095250506 12:39973423-39973445 GGGGAGAAGAGAAGGAATCTGGG - Intronic
1095942361 12:47735486-47735508 GGCAAGAGGACACAGACTCTGGG - Intronic
1096059979 12:48689129-48689151 GAAAAAAAGAGAAGGACTCTTGG - Exonic
1096246592 12:49992676-49992698 GGAAAGAAGTCTAGGCCTCTTGG - Intronic
1096468768 12:51863728-51863750 GGGAGGAAGCCAAGGGCCCTCGG - Intergenic
1096528873 12:52231187-52231209 GGGAAGGAGAAAAGGTCTCTGGG - Intergenic
1096695883 12:53347957-53347979 AGAAAGAACACAAGGACTTTTGG - Intergenic
1096808515 12:54155291-54155313 GGGAAGAGGGGAAGGACTGTGGG - Intergenic
1099147425 12:79064186-79064208 GTGAAGAAGACAGGGAATGTAGG + Intronic
1099894153 12:88623981-88624003 GGGCAAAAGACAAGGTCACTGGG + Intergenic
1100366585 12:93926804-93926826 GGGAAGAAGACCATGGCACTGGG + Intergenic
1103093411 12:118113859-118113881 GGGAAGAAGACTAGGGGTTTGGG - Intronic
1103225182 12:119281255-119281277 GGGCAGAACATAAGGACACTTGG - Intergenic
1105503596 13:20992023-20992045 GGGAAGAACACAGGGACTGGTGG + Intronic
1105624679 13:22101398-22101420 GGGCAGAACGCAAGGACTATGGG + Intergenic
1106087064 13:26552187-26552209 GGGAAAAAGACAATTTCTCTGGG + Intergenic
1106159655 13:27189523-27189545 GGTAACAAGACCAGAACTCTAGG - Intergenic
1106837129 13:33646436-33646458 TAGAGGAATACAAGGACTCTGGG + Intergenic
1106885774 13:34182738-34182760 TGGAAGAAGACACAGACTCAAGG - Intergenic
1107789765 13:43990023-43990045 GGGTAGCAGAGATGGACTCTAGG - Intergenic
1108492489 13:50995069-50995091 GGCCAGAAGACAAGGAGACTTGG - Intergenic
1108605995 13:52039136-52039158 GAGAAGGAGAGAAGGACTCATGG + Intronic
1110300738 13:73923740-73923762 GGGAAGAAGAAAAACACCCTGGG - Intronic
1110392902 13:74995840-74995862 GGGCAGAACAAAAGGAATCTAGG + Intergenic
1110765521 13:79276556-79276578 GGGAAGCAGTCAGGGAGTCTTGG - Intergenic
1111566567 13:90024527-90024549 TGAAAGAACACAAGGATTCTTGG - Intergenic
1111825179 13:93258615-93258637 GGGCAGAAGACAAACAATCTTGG + Intronic
1115353358 14:32421462-32421484 CGGAACAAAAAAAGGACTCTGGG - Intronic
1116445770 14:45009092-45009114 GAGAAGAAGTCAATGATTCTTGG - Exonic
1117836748 14:59815797-59815819 GGGAAGGAGAAATGGACTCTAGG - Intronic
1117920013 14:60719975-60719997 GGGAATGAGACAGGGACACTGGG + Exonic
1118349341 14:64962284-64962306 GGGAAGAACAGAAGTCCTCTAGG + Intronic
1118484240 14:66198695-66198717 GGGCAGAACACAAGGACCCCTGG - Intergenic
1118768292 14:68924828-68924850 GTGCAGAAGAACAGGACTCTGGG + Intronic
1118989716 14:70786846-70786868 AGGAAGGAGAAAAGGACTGTGGG - Intronic
1120145499 14:80974315-80974337 TGGAAGAAGATAAGAACTCTTGG - Intronic
1120201143 14:81539665-81539687 GGGAAGAAGAATAAGAATCTTGG + Intergenic
1121981344 14:98457136-98457158 GGTAAGAAAACAAGGGCTCAAGG + Intergenic
1123145360 14:106124589-106124611 GAGAATAAGACAAGGACAGTAGG - Intergenic
1124203060 15:27694864-27694886 GGAAAGAAGACTAGCTCTCTAGG + Intergenic
1124591410 15:31057016-31057038 GGGAGGAAGACATGGGGTCTAGG + Intronic
1124832673 15:33164046-33164068 AGGAAGAAGACATGGGCTCAAGG + Intronic
1125177051 15:36835951-36835973 TGTAAGAAGACAAGCTCTCTAGG + Intergenic
1125805577 15:42490916-42490938 GGGCAGACGACCAGGACCCTTGG + Intronic
1125842985 15:42822933-42822955 AGAAAGAAGAGAATGACTCTAGG + Intronic
1126622795 15:50656735-50656757 AGGAAGAAGAGAAGGTCTCTGGG - Intronic
1127535613 15:59887153-59887175 GGCAATGAGACCAGGACTCTTGG + Intergenic
1128906732 15:71474084-71474106 GGGGAGCAGACTAGGACACTGGG - Intronic
1129138497 15:73575579-73575601 GGGAGGTAGACAAGGACACGAGG - Intronic
1131559456 15:93426853-93426875 GGGAAGAAGACCAGTCCTCCCGG + Intergenic
1132865029 16:2089051-2089073 GGGAGGATGACAAGGCCTCTGGG + Exonic
1136693745 16:32057194-32057216 GAGAAAAAGACAAGGACAGTAGG + Intergenic
1136794233 16:33000429-33000451 GAGAAAAAGACAAGGACAGTAGG + Intergenic
1136875674 16:33853950-33853972 GAGAAAAAGACAAGGACAGTAGG - Intergenic
1137626824 16:49914311-49914333 GGGAAGAAGAACAGGCCCCTGGG + Intergenic
1139014390 16:62672349-62672371 GAAAAGAAGACAAGGAATCCAGG + Intergenic
1139168653 16:64602989-64603011 AGGAAGAAGACAAAGAGTCTAGG + Intergenic
1140561815 16:75991609-75991631 GGGAATAGCACAAGGATTCTTGG + Intergenic
1140997218 16:80272623-80272645 GGGAAGAAGACAGAGAATTTGGG + Intergenic
1203096497 16_KI270728v1_random:1262110-1262132 GAGAAAAAGACAAGGACAGTAGG + Intergenic
1143121199 17:4608102-4608124 GGGAAGAACAGGAGGACTTTGGG - Exonic
1143334331 17:6161009-6161031 GGGAAGAAGACAACGTCTACTGG - Intergenic
1143994845 17:10997442-10997464 GGGAAGAAGAGCATGACCCTGGG - Intergenic
1144301050 17:13923272-13923294 GGGAAGAATACAAGGATTAATGG + Intergenic
1144842623 17:18197504-18197526 GGGAAGATGAGAGGAACTCTTGG - Intronic
1146815160 17:35936669-35936691 GGGCAGTAGGCAAGGACTCACGG - Intronic
1149207142 17:54261453-54261475 AGGAAGAATACAAGGTATCTTGG + Intergenic
1149588212 17:57807890-57807912 GGCAAGAAGTCAAGGAATGTGGG + Intergenic
1150225858 17:63524058-63524080 GGAAAGATCATAAGGACTCTTGG - Intronic
1150898547 17:69241694-69241716 GGGAGGGAGATAAGGACTCTTGG - Intronic
1150931543 17:69590339-69590361 GGGGAGAAGAGAAGGAATGTCGG - Intergenic
1151523935 17:74650881-74650903 GGAAAGAAGACAAGGAATCCAGG + Intergenic
1154077025 18:11213326-11213348 GGCAAGGAGACAAGGACATTGGG + Intergenic
1154180364 18:12133072-12133094 GGGATGAAGAGAAGGATTATAGG - Intergenic
1155721771 18:29022618-29022640 GGGAAGAAGGAAAGGATTCAAGG - Intergenic
1156115505 18:33782329-33782351 GGTAAAAAGAAAAGAACTCTAGG - Intergenic
1156516711 18:37686234-37686256 GGGAAGTAGAGAAGATCTCTGGG + Intergenic
1157328309 18:46685212-46685234 GGGGAGAAGCCCAGGTCTCTGGG - Intronic
1157399391 18:47374438-47374460 GAGGAGAAGACAAGGTTTCTTGG + Intergenic
1157724440 18:49953018-49953040 GGGAAGAAAGCAAGGAGTGTAGG - Intronic
1157967215 18:52221944-52221966 AGGGAGAAAACAAGGTCTCTTGG + Intergenic
1158435653 18:57434317-57434339 GGGCAGACGACAAGGAATCCTGG - Intergenic
1158860023 18:61582606-61582628 GGGGAGAACACACGGACTTTGGG - Intergenic
1158917268 18:62146417-62146439 GAGAAGATGGCAAGGTCTCTGGG + Intronic
1159789165 18:72755516-72755538 GGGAAGGAGGCAAGGGCTTTGGG + Intronic
1160949503 19:1658673-1658695 GGAAAGACGACAAGGATCCTAGG + Intergenic
1162783529 19:13020169-13020191 GGGGAGAAGAGAAGGAGGCTGGG + Intronic
1164704777 19:30312251-30312273 GGGGAGAAGAGAAGGTCTGTGGG + Intronic
1165047616 19:33118072-33118094 AAGGAGAAGACAATGACTCTAGG + Intronic
1165824572 19:38698472-38698494 GGGAGGGAGACAAGAACTGTTGG + Intronic
1166555672 19:43698231-43698253 GGGCATAAGAACAGGACTCTAGG + Intergenic
1166774065 19:45301999-45302021 GTGAAGATGACAAGGGCTCCAGG - Intronic
1167312350 19:48744383-48744405 GGGCTGGAGACAAGGACTCTTGG + Intronic
1168073537 19:53965813-53965835 GGGAAGTAGATAAGGAATCTAGG + Intronic
926245153 2:11117834-11117856 GGGAAGGAGGAAAGGACTCAGGG - Intergenic
926965084 2:18401104-18401126 GGGATGAAGACAGGGAGTATGGG + Intergenic
927975957 2:27338405-27338427 GAGAAGACGACAGGAACTCTGGG - Intronic
928015556 2:27653662-27653684 GTGAAGAAGGCAATGTCTCTGGG - Exonic
928426755 2:31185140-31185162 TGGAAGAAGACATGGAATATAGG - Intronic
929279010 2:40057789-40057811 GGGTATAAGACAGGAACTCTGGG + Intergenic
929333981 2:40717527-40717549 GAGAAGAAGACAAGCACCATTGG - Intergenic
930874620 2:56200831-56200853 TGGAAGAATACAAGAAGTCTTGG + Intronic
932579628 2:72984932-72984954 GGGAAGAAGAAACTGACTCTTGG + Intronic
932585104 2:73022685-73022707 GGGAAGAAGACAACTTCTCTGGG + Intronic
932895513 2:75635776-75635798 TGGTAGAAGACATAGACTCTTGG - Intergenic
935376250 2:102400553-102400575 GAGATGAAGAAACGGACTCTAGG + Intergenic
935648179 2:105359032-105359054 TGGAAGAAGAGAACGACACTGGG - Intronic
936607325 2:113971645-113971667 GGAAAGATGACTAGGAGTCTGGG + Intergenic
938121458 2:128637058-128637080 GGGAAGAGGACAGGGCCTCCTGG - Intergenic
939328049 2:140720922-140720944 GGGTAGAAAACAAGGAGTCTAGG + Intronic
939676343 2:145077361-145077383 GTGAAGAACTCAAGGACTCAAGG - Intergenic
939733935 2:145819722-145819744 TCCAAGAAGAAAAGGACTCTTGG - Intergenic
940198090 2:151118665-151118687 GGGAAGAATACAAGTAAACTAGG - Intergenic
940424138 2:153511525-153511547 GGGAAGAACATAACCACTCTAGG + Intergenic
941427176 2:165362705-165362727 GGGCAGAAGCCACGTACTCTAGG - Intronic
942022185 2:171876881-171876903 GGCAAGAAGTCAAGGACACATGG + Intronic
944406643 2:199392242-199392264 GGGAAAAAAAAAAGGAATCTGGG - Intronic
945505736 2:210638029-210638051 GGAAAGAAGGAAAGGACACTAGG + Intronic
945827077 2:214734845-214734867 GGGAAGGATACAAGTACTTTTGG - Intronic
946483463 2:220078455-220078477 AGGAAGAAGAGAAGGAGCCTGGG + Intergenic
948245920 2:236485927-236485949 GGGAAGAAGACCAGGAGGCGGGG - Intronic
948517559 2:238513516-238513538 AGGAAGAAGACTAGCTCTCTGGG - Intergenic
1169591408 20:7147036-7147058 GGGGAGAGGACAAGGGCACTGGG - Intergenic
1169956546 20:11109481-11109503 GGTCAGAAGACAAACACTCTTGG + Intergenic
1169962794 20:11180568-11180590 TGGAAGATGTCAAGGACTGTAGG - Intergenic
1171196203 20:23201361-23201383 GGGAAGAAGCCATGGAATCATGG + Intergenic
1171342720 20:24443317-24443339 GGGAAGATGAGCAGGACTCTTGG + Intergenic
1171402030 20:24879941-24879963 TGGAAGAACACAAGGCCTCCAGG - Intergenic
1173084613 20:39903948-39903970 AGGAAGCAGACAATGTCTCTTGG + Intergenic
1173359753 20:42332107-42332129 GTGAAAAAGACATGGACTCAAGG - Intronic
1175418928 20:58819238-58819260 TGGAAGCAGACAGGGACCCTTGG + Intergenic
1175619322 20:60430311-60430333 AGGAAGAAGGCAAGGGCTCTAGG - Intergenic
1176647788 21:9366800-9366822 GGATAGAGGACACGGACTCTGGG - Intergenic
1178365520 21:31986266-31986288 GGGTCAAAGTCAAGGACTCTTGG - Intronic
1179013593 21:37575294-37575316 AGTGAGAAGACAAGGAGTCTAGG - Intergenic
1180566269 22:16668457-16668479 GGGATGAAGAGAAGGATTATGGG + Intergenic
1182660069 22:31918900-31918922 TGGAAGAAGACAGGGACTGCAGG - Intergenic
1184333173 22:43838626-43838648 TGGTAGAAGAGAAGGGCTCTGGG + Intronic
1184934828 22:47713746-47713768 GGGCAGAGGAGAAGGACCCTGGG + Intergenic
950038196 3:9902409-9902431 GGGAAGAAAAAAAGCACTCTAGG - Intergenic
950185948 3:10945669-10945691 GGGAAAAAGCCAAGAATTCTGGG - Intergenic
951069927 3:18315594-18315616 GATAAGAACACATGGACTCTAGG - Intronic
951529017 3:23681602-23681624 GGGAAGTTGACAGGGGCTCTCGG - Intergenic
952494326 3:33902623-33902645 GGGAAGAAGTCAAGGGCACAGGG + Intergenic
952748505 3:36804411-36804433 GGGAAGAAGAGAAATACCCTGGG + Intergenic
952934437 3:38384678-38384700 GGAAAGAAGGAAAGGAGTCTGGG - Intronic
954332632 3:49899024-49899046 GGGATGGAGACAAGGACCCAGGG + Intronic
954808017 3:53231528-53231550 GGGTAGAAGATAAGGAGTCTTGG - Exonic
955904491 3:63792555-63792577 GGGTAGAAGACCAGGACACTGGG + Intergenic
957898335 3:86452516-86452538 AGTAAGAAGACATGGACTCAGGG - Intergenic
957923664 3:86779785-86779807 GAGAAGAAGAAAAGAACTATAGG - Intergenic
958015364 3:87934063-87934085 GGGAGGAAGACTAGGAATGTGGG - Intergenic
958682260 3:97346170-97346192 GGGAAGAACACAAGGACTTTAGG - Intronic
958918947 3:100081206-100081228 GTGAAGATTAGAAGGACTCTTGG - Intronic
959324874 3:104924448-104924470 GAAAAGAAGAGAATGACTCTAGG + Intergenic
960010660 3:112831421-112831443 GTGAAGAATACAATGACTATTGG + Intronic
961218731 3:125183096-125183118 GGGAAGCAGCCCAGGACTCAAGG + Intronic
962723753 3:138201409-138201431 GGGAAGAAGACAAGGACTCTAGG - Intronic
962829914 3:139130947-139130969 GGGAAGATGACACAGCCTCTGGG + Intronic
963115725 3:141727527-141727549 GAGAAGGAGAGAAGGAATCTGGG - Intergenic
963272966 3:143303397-143303419 GGGAAGGAGGCAAGGCCTCTTGG + Intronic
964094326 3:152914071-152914093 AGGAAAAAGACAATGACTTTGGG - Intergenic
964351685 3:155809491-155809513 GGGAAGAAGAAAAGGTCACTGGG - Intergenic
965890073 3:173501484-173501506 GGGAAGTAGATAAAGTCTCTGGG - Intronic
966230486 3:177646254-177646276 AAGAAGAAAACAAGGACTGTTGG - Intergenic
967009737 3:185421552-185421574 GGGAAAAAGACAAGGAACATTGG - Intronic
967752158 3:193127276-193127298 GGGAAGAGGACAAGGATACAAGG - Intergenic
969149273 4:5154845-5154867 GGGAAGAGGACAGCAACTCTTGG + Intronic
970010169 4:11449717-11449739 GAGAGGAAGACAAGGCCACTTGG - Intergenic
971317042 4:25576268-25576290 GAGAAGAGTTCAAGGACTCTGGG - Intergenic
972406262 4:38749480-38749502 GAGATGAAAACAAGGACTCCAGG - Intergenic
972713548 4:41623164-41623186 ATGAAAAAGAAAAGGACTCTTGG + Intronic
972903207 4:43711087-43711109 GGGAGGAAGAGAAGGAGTCAGGG - Intergenic
973034913 4:45393975-45393997 GAAAAGAAGACAAGGAATATGGG - Intergenic
973532632 4:51848384-51848406 GGGAAAAGGACAAACACTCTAGG - Intronic
974122791 4:57660132-57660154 GTGAACAAGAAAAGGACTCCTGG - Intergenic
974134874 4:57803105-57803127 GGCTAAAAGAAAAGGACTCTGGG - Intergenic
974345843 4:60679902-60679924 GGGACTCAGACAAGGACTCTGGG + Intergenic
975460885 4:74651343-74651365 GGGAAGAAGAAATGTATTCTAGG + Intergenic
975516439 4:75253604-75253626 GGGAAGAATACAAGGAAGGTAGG - Intergenic
976353256 4:84084576-84084598 GGGAAGAAGAGGGGCACTCTAGG + Intergenic
976414043 4:84750992-84751014 GGTAAGAAGACAATGCCACTAGG + Intronic
977925115 4:102691873-102691895 AGGAAGATGATAAGGATTCTGGG + Intronic
978570767 4:110134501-110134523 TGTAAGAACACAAGGCCTCTGGG + Intronic
979303839 4:119119573-119119595 TGGAAGAAGACATGAACTCCTGG - Intergenic
979451874 4:120882048-120882070 AGGAAGGAGGCAAGGAATCTGGG - Intronic
981569772 4:146139161-146139183 GGGAAAAAGATAAGGATTATAGG - Intergenic
982780949 4:159490903-159490925 TGGAAGAAGAGAAGAACTGTAGG + Intergenic
984510225 4:180669827-180669849 CGGAGGAACACAAGGAATCTCGG - Intergenic
984914343 4:184707530-184707552 AGGAAGAAAAGATGGACTCTGGG - Intronic
984994538 4:185416527-185416549 GGGAAAAGGTCAAGCACTCTAGG + Intronic
987519023 5:18954133-18954155 GGAAATAACACAATGACTCTTGG - Intergenic
988538368 5:32088280-32088302 GGGAAGATGAGCAGGACTCGAGG - Exonic
989555549 5:42790662-42790684 GAGAAGAAAAGAAGGAATCTTGG + Intronic
991202040 5:64006038-64006060 GGGAAGAAGACAAGGGATGGTGG - Intergenic
991943009 5:71872942-71872964 GGGGAGAAGAAAGGGACTCTAGG + Intergenic
997389786 5:133504680-133504702 GGGAGGAAGACGAGAGCTCTGGG - Intronic
998553113 5:143096717-143096739 GTGAAGAATACAATGACTATTGG + Intronic
998922586 5:147085837-147085859 GGGAAGAAGTGAAGGAATCTTGG + Intergenic
999719264 5:154386562-154386584 GTGAAGAAGACAGGGGCTCATGG + Intronic
999755308 5:154659774-154659796 GGGAAGGAGTCAGGGGCTCTGGG - Intergenic
1000094105 5:157955857-157955879 GAGAAGAGTAAAAGGACTCTAGG + Intergenic
1001957895 5:175860839-175860861 TGGAAGAAGACAGGAACTCCAGG + Intronic
1002139528 5:177130599-177130621 GGGGAGAAGACCAGGACCCCAGG - Intergenic
1003740477 6:8932266-8932288 AAGAAGAATACAAGGACTCATGG - Intergenic
1003981417 6:11393773-11393795 CAGAAGAAGAAAAGGTCTCTTGG + Intergenic
1004488108 6:16087168-16087190 GGGATGATGTCAAGGGCTCTGGG + Intergenic
1004917356 6:20344418-20344440 AGGAAGAAGCGATGGACTCTTGG - Intergenic
1005262779 6:24079608-24079630 AGGAAGAAGACAGGACCTCTAGG - Intergenic
1007415869 6:41690925-41690947 GGGGAAAAGGCAAGGGCTCTAGG + Intronic
1007514528 6:42400687-42400709 TGGGAGAAGACGAGGACTCACGG + Intronic
1008485497 6:52030655-52030677 GGGAAGAAGGCAAGGGAACTGGG + Intronic
1010337860 6:74709914-74709936 AGGGAGAAGACATGGAATCTGGG - Intergenic
1010556847 6:77292633-77292655 GGGAAGGAGGCAGTGACTCTGGG - Intergenic
1011967300 6:93174928-93174950 GGGAAAAAGTAAAGGACTGTAGG - Intergenic
1012084436 6:94806468-94806490 GGGAAGAAGATAAAGACTGGAGG + Intergenic
1012860235 6:104550963-104550985 GAGAAGCAGGCATGGACTCTTGG + Intergenic
1015211110 6:130700284-130700306 GGGAAGGAGATGAGGACACTGGG - Intergenic
1016313865 6:142764411-142764433 GGGAAGAAAACATGTGCTCTTGG - Intronic
1016622589 6:146129557-146129579 GGGAAGATGACAAGGACTTGTGG + Intronic
1016915927 6:149244451-149244473 AGGAAGGAGACAAGGACTCTGGG + Intronic
1017790110 6:157790483-157790505 AGGAAGAAAATAAGGACTGTCGG - Intronic
1018054464 6:160040092-160040114 GTGAACAAGACAAGTTCTCTGGG - Intronic
1018174423 6:161166620-161166642 GGGAAGAAGAGAAGGATACTTGG + Intronic
1019166154 6:170098824-170098846 GGGAAGAAGACTAGACCCCTGGG + Intergenic
1019854676 7:3592909-3592931 GGCAGGAGGACAAGGACTCCAGG - Intronic
1020930633 7:14388948-14388970 AGCATGAAGACAAGCACTCTTGG + Intronic
1021788118 7:24172842-24172864 GTCCAGGAGACAAGGACTCTGGG - Intergenic
1021930877 7:25580060-25580082 GGGAAGAAGAAATGGATACTGGG + Intergenic
1025308751 7:57898154-57898176 GAAAACAAGACAAGAACTCTCGG + Intergenic
1026145702 7:67744629-67744651 GGGAGGAAGAAAGGGACCCTGGG - Intergenic
1026326071 7:69311821-69311843 TGGTTGAAGACATGGACTCTAGG - Intergenic
1026661993 7:72310457-72310479 GGGCAGAACAAAAGGAATCTTGG + Intronic
1027515321 7:79135552-79135574 GGGAAGCAGAGGAGGATTCTGGG - Intronic
1029460035 7:100689151-100689173 GGGTACACGACAAGGACTCCAGG + Exonic
1029547412 7:101217535-101217557 GGGCGGGAGACAGGGACTCTGGG + Exonic
1031049523 7:116930847-116930869 GCCAAGAACACAAGGATTCTTGG + Intergenic
1032580061 7:133096155-133096177 GGGAAAAGGAAAAAGACTCTCGG + Intergenic
1032949764 7:136894023-136894045 GTGAATAATACTAGGACTCTAGG - Intronic
1034541072 7:151758585-151758607 GGGAAGAACACCATGTCTCTGGG - Intronic
1035521852 8:280934-280956 GAAAAGAAGACAAGAATTCTAGG + Intergenic
1035999874 8:4590290-4590312 GGGAAGCAGACATGGACTACTGG + Intronic
1036189913 8:6660778-6660800 GGGAAGAAGCAAAGGCATCTCGG + Intergenic
1036194824 8:6705024-6705046 GGAAAGGAGACAAGGATGCTAGG - Intergenic
1036286088 8:7445201-7445223 GGGAGGAAGCCGAGGACCCTGGG + Intronic
1036335386 8:7866328-7866350 GGGAGGAAGCCGAGGACCCTGGG - Intronic
1037326426 8:17695893-17695915 GGAGAGCAGACAGGGACTCTGGG + Intronic
1039022148 8:33219589-33219611 GGGCAGAAGACAGGTACTCAAGG - Intergenic
1039489457 8:37936611-37936633 GGGAGGGAGCCAAGGACTCTAGG - Intronic
1039694940 8:39900784-39900806 GGGACTAGGAGAAGGACTCTTGG - Intergenic
1040286498 8:46103210-46103232 GGGAAGACCACAGGGACTCAGGG - Intergenic
1040311128 8:46237398-46237420 GGGAGGAAGGCAGGGACTCAGGG + Intergenic
1040311539 8:46239327-46239349 GGGCAGGAGACAGGGACTCAGGG + Intergenic
1040311673 8:46239972-46239994 GGGAGGAAAACAGGGACTCAGGG + Intergenic
1040454118 8:47578788-47578810 GGGAATTAGACAAGTACACTTGG + Intronic
1042259949 8:66848433-66848455 AAGAAGAAGAAAAGGAATCTGGG - Intronic
1042571579 8:70171173-70171195 GGGAAGGAGATAAAGAATCTAGG + Intronic
1044443511 8:92247336-92247358 GGCAAGAAGACAGTCACTCTGGG - Intergenic
1044848161 8:96402050-96402072 GGGAAGAGGATGAGGATTCTAGG - Intergenic
1045703523 8:104894352-104894374 GGGAAGAAGAGAAAGTCTATAGG - Intronic
1046086495 8:109443319-109443341 TGGAAGCACACAAGGATTCTGGG - Intronic
1048518918 8:135136137-135136159 GGGAAGAAAACAATGACTTTTGG + Intergenic
1051095196 9:13458325-13458347 GGGAAGAAGACAAGGAGATCCGG - Intergenic
1053395240 9:37767573-37767595 GGGTAGGAGAAAAAGACTCTGGG - Intronic
1053419726 9:37969813-37969835 GGGAAGGGGACAAGGAGCCTTGG - Intronic
1054882208 9:70155722-70155744 GGGCAGAAGACAAGGATTTGAGG - Intronic
1055471562 9:76616927-76616949 GGGAAGGAGACAAGCACCCAGGG + Intronic
1056853759 9:90107143-90107165 GGGAAGAGAACAAGGCTTCTGGG - Intergenic
1057609789 9:96530722-96530744 ATGAAGAAGACAAGGAGGCTTGG - Intronic
1058795050 9:108489861-108489883 GGTAAGAAGACAAAGTTTCTGGG - Intergenic
1059666668 9:116452927-116452949 TGGAAGAAGAGAAGGGCTTTAGG - Intronic
1060622447 9:125080293-125080315 GGGAAGAAGAACATGACTTTGGG - Intronic
1060802509 9:126553736-126553758 GGGGAGGAGACAAGCGCTCTGGG - Intergenic
1061034027 9:128103550-128103572 GGGAGAAGGCCAAGGACTCTGGG - Intronic
1061491233 9:130945580-130945602 AGGAAGATGACAAGGAAACTAGG - Intergenic
1061511157 9:131061641-131061663 GGAAAGAATACAAGGAGCCTGGG - Intronic
1061769759 9:132909855-132909877 GGGAAGAATGCAAGGCCTCTTGG + Intronic
1062575259 9:137203788-137203810 GGCAAGAAGTCATGGGCTCTGGG + Intronic
1186420022 X:9418242-9418264 GGGAGGAAGACAAGGAAACCAGG - Intergenic
1186683505 X:11900405-11900427 GGGAAGAAGAGAAGGAGCATGGG + Intergenic
1187038784 X:15570775-15570797 AGAAAGAAGACATGGAATCTAGG + Intronic
1187187212 X:16998331-16998353 GGGAAGAAAACAAGGTGGCTAGG - Intronic
1188011381 X:25059948-25059970 GGGAGAAAACCAAGGACTCTGGG + Intergenic
1188884930 X:35537888-35537910 GGTAAGAAGACAATGATTCTGGG + Intergenic
1189232876 X:39465958-39465980 GGGAGGGGGACAAGGACCCTGGG - Intergenic
1189564998 X:42232438-42232460 GGGAAGAAAAGAAGGAGTTTTGG + Intergenic
1191001140 X:55660655-55660677 TGGAAGAAGAAAAGGAGTCGTGG - Intergenic
1192392187 X:70741749-70741771 GGGAGGAAGAAAATGACTCCAGG - Intronic
1194511526 X:94801943-94801965 GGAAAGAAGAACAGGACTTTTGG - Intergenic
1196519945 X:116661319-116661341 GGGAAGAATACAAGGATTAAAGG + Intergenic
1196756403 X:119161084-119161106 AAGAAGAAAACAAAGACTCTTGG - Intergenic
1197124604 X:122929632-122929654 GTGAAGAAGACAAGAATTGTAGG + Intergenic
1197329276 X:125133571-125133593 GGGGAGGAGACAAGGACTTTAGG - Intergenic
1198409130 X:136348092-136348114 TGGAAAGAGACAAGGACTCAGGG - Exonic
1198804550 X:140481139-140481161 GGGAAGAAGAGAAGGAGCATGGG - Intergenic
1199000226 X:142627512-142627534 GGAAAAAAGACAAGGAATGTGGG + Intergenic
1199881941 X:151980817-151980839 GGGAAGAAGAGAAGGAGCCAGGG + Intergenic
1199941812 X:152635178-152635200 CGGAAGAAGACAAGAACCCAGGG - Intergenic
1200986601 Y:9307363-9307385 GATAAGAGGACAAGGACTCAGGG - Intergenic
1202123985 Y:21553553-21553575 GATAAGAGGACAAGGACTCAGGG + Intergenic
1202155023 Y:21875827-21875849 GATAAGAGGACAAGGACTCAGGG - Intergenic