ID: 962728309

View in Genome Browser
Species Human (GRCh38)
Location 3:138256049-138256071
Sequence CTGCTCCAATGTAAGATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962728309_962728316 11 Left 962728309 3:138256049-138256071 CCAAACATCTTACATTGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 962728316 3:138256083-138256105 TTACATAACAGGGTATGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 97
962728309_962728315 10 Left 962728309 3:138256049-138256071 CCAAACATCTTACATTGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 962728315 3:138256082-138256104 ATTACATAACAGGGTATGGATGG 0: 1
1: 0
2: 2
3: 9
4: 134
962728309_962728312 0 Left 962728309 3:138256049-138256071 CCAAACATCTTACATTGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 962728312 3:138256072-138256094 TGGCACAGGTATTACATAACAGG 0: 1
1: 0
2: 0
3: 6
4: 100
962728309_962728314 6 Left 962728309 3:138256049-138256071 CCAAACATCTTACATTGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 962728314 3:138256078-138256100 AGGTATTACATAACAGGGTATGG 0: 1
1: 0
2: 1
3: 8
4: 125
962728309_962728313 1 Left 962728309 3:138256049-138256071 CCAAACATCTTACATTGGAGCAG 0: 1
1: 0
2: 0
3: 5
4: 102
Right 962728313 3:138256073-138256095 GGCACAGGTATTACATAACAGGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962728309 Original CRISPR CTGCTCCAATGTAAGATGTT TGG (reversed) Intronic
904313452 1:29644424-29644446 CTGCTCTAATTTTAGATTTTGGG - Intergenic
909715699 1:78703702-78703724 CTGATGGAAGGTAAGATGTTTGG + Intergenic
911186553 1:94910314-94910336 CTGCTAGAATGTAAGCTTTTAGG - Intronic
920724141 1:208417812-208417834 CTGCTCCATTGCAAGAAGTCAGG + Intergenic
921141482 1:212311048-212311070 CAGCTCCACTGTAATATTTTGGG - Intronic
921394467 1:214653830-214653852 CTGCTACAAAATGAGATGTTGGG + Intronic
922659220 1:227414724-227414746 CTGCTGCTGTGTAATATGTTAGG + Intergenic
1064974598 10:21100385-21100407 CTGCTCCATTGTCAGCTGTGCGG + Intronic
1070660865 10:78304338-78304360 CCTCTCCACTGTATGATGTTGGG + Intergenic
1072450957 10:95539288-95539310 CTTGTCCACTCTAAGATGTTCGG + Intronic
1072464248 10:95648552-95648574 CAGCTCAAATTTAAGAAGTTTGG - Intronic
1075200343 10:120397388-120397410 TTGATCCAATCTATGATGTTTGG - Intergenic
1081313188 11:41598781-41598803 CTGGTCTTATGTAAGATATTGGG - Intergenic
1086215901 11:84380651-84380673 AGTCTCCAAAGTAAGATGTTAGG + Intronic
1088902221 11:114126992-114127014 CTGCTCCAATGAAAGAAGAAAGG - Intronic
1092386504 12:8039613-8039635 CTGCTCCACAATAAGATGTAGGG + Intronic
1093909344 12:24727785-24727807 CTACTCTAGTGTAAGATTTTTGG + Intergenic
1098881784 12:75924870-75924892 CCACCCCAATGCAAGATGTTGGG - Intergenic
1105804962 13:23947316-23947338 TTTCTCCCATGGAAGATGTTTGG - Intergenic
1106214286 13:27680612-27680634 ATGCCCAAATGTATGATGTTTGG + Intergenic
1110002437 13:70221386-70221408 CTACTCTGATGTAAGATGTGTGG - Intergenic
1111996622 13:95172072-95172094 CATCTACAATGGAAGATGTTAGG - Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1119012561 14:71010205-71010227 CTGTGCCACTGTAAGATCTTCGG - Intronic
1121040186 14:90739993-90740015 CTGCTCTAATGTAATTTATTTGG + Intronic
1121446931 14:93984857-93984879 CTGGTGCATTGTAGGATGTTTGG - Intergenic
1121708505 14:96019431-96019453 CTGCTCCAAAATAGGATGTGAGG - Intergenic
1124827586 15:33114060-33114082 CTGCTCCAAGAGAAGGTGTTGGG - Intronic
1130449058 15:84032420-84032442 CTCCTCAAATGGAAAATGTTTGG + Intronic
1134836078 16:17362074-17362096 GTTCTCCAGTGTAAGATGCTGGG - Intronic
1135718413 16:24793129-24793151 CTGCTCCAATTTACAAGGTTTGG + Intronic
1137553424 16:49455590-49455612 CAGCTCTAATGTGGGATGTTGGG + Intergenic
1142539772 17:649177-649199 GTCCTCCAGTGTAAGATCTTCGG - Intronic
1142539783 17:649259-649281 GTCCTCCAGTGTAAGATCTTCGG - Intronic
1142539789 17:649300-649322 GTCCTCCAGTGTAAGATCTTCGG - Intronic
1142539795 17:649341-649363 GTCCTCCAGTGTAAGATCTTCGG - Intronic
1142539801 17:649382-649404 GTCCTCCAGTGTAAGATCTTCGG - Intronic
1149780895 17:59395669-59395691 CTGCTTCTATGTCAGATGTGTGG - Intronic
1150239516 17:63621145-63621167 CTGTTCCAGTGTAATATGTCAGG - Intergenic
1150957842 17:69881086-69881108 CTCCTCCCAAGCAAGATGTTTGG + Intergenic
1155382981 18:25244942-25244964 CTGCTCCATTGGAAAATGTGTGG + Intronic
1157016371 18:43719798-43719820 ATGCTCCCATGTAAGGTGTCTGG - Intergenic
1166253973 19:41589430-41589452 CTGCTGAAATGTAGGATGTGAGG - Intronic
1167845397 19:52159730-52159752 CTGGACCAAAGTAATATGTTTGG + Intronic
925634121 2:5925964-5925986 CAGCTCAGATTTAAGATGTTTGG - Intergenic
927127934 2:20030357-20030379 CTCCTGCAATGTAAGATGCTTGG - Intergenic
928461063 2:31473057-31473079 CTGCTCAAATGTAATGTTTTTGG - Intergenic
936853797 2:116933317-116933339 ATGCTCCATTTTAGGATGTTTGG + Intergenic
939158613 2:138557480-138557502 ATGGTCCAATGTAAAATGTTTGG - Intronic
942112018 2:172692021-172692043 GTGCTCCAATGTAGGATTCTTGG - Intergenic
944220388 2:197298283-197298305 CTTGTCCAGTGTAAGATATTTGG - Intronic
1170348065 20:15408886-15408908 CTGCTTCAAGGTAAGCTCTTTGG + Intronic
1177027249 21:15934718-15934740 CTGATCCAAGGTAGTATGTTGGG - Intergenic
1177957045 21:27611260-27611282 CTACTCCATTGCAAGATATTGGG - Intergenic
1178120641 21:29466729-29466751 CTGCTCCAATGCATGGGGTTGGG + Intronic
1184997431 22:48218957-48218979 CTGCTCCAGGATAAAATGTTAGG + Intergenic
953216415 3:40922909-40922931 CTGCTCCAAGGTAAGGTGAGAGG + Intergenic
954940571 3:54368662-54368684 CTGCTCCAAGGTAATATTTGGGG + Intronic
955905359 3:63801905-63801927 CTGATACCATGTAAGATGCTAGG - Intergenic
958620724 3:96555920-96555942 CTTATGCAATATAAGATGTTTGG - Intergenic
961266951 3:125651127-125651149 CGGCTCAGATGTAAGATGATTGG + Intergenic
962728309 3:138256049-138256071 CTGCTCCAATGTAAGATGTTTGG - Intronic
963488460 3:145967508-145967530 CAGCTGGATTGTAAGATGTTAGG - Intergenic
971462561 4:26916860-26916882 CTCCTACAATGTATCATGTTAGG - Intronic
971585303 4:28398489-28398511 TTGCTATACTGTAAGATGTTTGG + Intronic
972699758 4:41482735-41482757 CTGCTCCATTGTAAGAGCTCAGG - Intronic
972724375 4:41733490-41733512 CTGTTCCATTGTAACATTTTTGG + Intergenic
974274747 4:59704058-59704080 CTGCACCTATGTGAGATGATGGG - Intergenic
975072896 4:70164385-70164407 CTGATCCAATGTAGGATATAGGG - Exonic
975320218 4:73001708-73001730 CTGCTCACATCAAAGATGTTAGG - Intergenic
975519799 4:75288365-75288387 CTGCTCCGATGTCATATTTTAGG + Intergenic
979223271 4:118254396-118254418 CTGCTAGTATGTTAGATGTTGGG - Intronic
981649419 4:147039059-147039081 CAGTTCCAATGTAACATGCTGGG + Intergenic
982967530 4:161931922-161931944 CTGGTACAATTGAAGATGTTTGG - Intronic
983006886 4:162494360-162494382 CTGTTTCCATGTAAGATGCTTGG + Intergenic
984617439 4:181914606-181914628 CTGCTAAAATATAAGATGTTTGG + Intergenic
985086498 4:186318412-186318434 CTCCGCTAATGCAAGATGTTAGG + Intergenic
987164882 5:15187326-15187348 CACCTCCAATGTAATATGTCTGG - Intergenic
992636956 5:78734214-78734236 GGGCTCCCATGTAAGATGTTTGG + Intronic
1003365511 6:5471190-5471212 CTCCTCAAATGAAAGACGTTTGG - Intronic
1004608331 6:17214805-17214827 CTGGTGCATTGTAGGATGTTTGG - Intergenic
1009572405 6:65403585-65403607 CTGCTACCATGTATGAGGTTGGG - Intronic
1009953536 6:70423947-70423969 CTGATCCACTATAATATGTTGGG - Intronic
1010175033 6:73018067-73018089 CTCCTCCAACATAATATGTTGGG - Intronic
1012688290 6:102280526-102280548 ATTCTCCAATATAACATGTTTGG - Intergenic
1013652425 6:112209246-112209268 CAGGCCCATTGTAAGATGTTAGG + Intronic
1015458454 6:133458572-133458594 CCTCTGCACTGTAAGATGTTTGG + Intronic
1018354602 6:162999891-162999913 ATGTTCCAAAGTAATATGTTAGG - Intronic
1021425441 7:20494945-20494967 CTTCTCCAATGTAAGACATGTGG + Intergenic
1027580209 7:79983618-79983640 CTGTTCCAAAGTCAGATATTGGG - Intergenic
1030309938 7:108058988-108059010 CTGCTCAAATATAAGGAGTTAGG + Intronic
1036572928 8:9997664-9997686 CTGTACAAATGTCAGATGTTGGG - Intergenic
1036951459 8:13143750-13143772 TGGCTACAATGTAAGAAGTTTGG + Intronic
1037249516 8:16876732-16876754 ATGCTCCTGTGTAAGATGTCTGG + Intergenic
1038646020 8:29363042-29363064 CTTCTGCAATGTAAGGTCTTGGG - Intergenic
1039344060 8:36684517-36684539 TTGTTCCAATGTAAGATCTCAGG + Intergenic
1040999342 8:53435237-53435259 CTACTAGAATGTAAGATTTTAGG + Intergenic
1041111739 8:54489310-54489332 CTGATCCAACCTGAGATGTTGGG - Intergenic
1045876437 8:106986503-106986525 CTTCTTGAATGTAAGATCTTAGG + Intergenic
1046633099 8:116641400-116641422 CTGCTCCAATGTGGGGAGTTTGG - Intergenic
1047118080 8:121867935-121867957 CTGCTAAAATGTAAGTTGATAGG + Intergenic
1047177284 8:122553751-122553773 CTGTTTCAATGTAAGAGGTGGGG + Intergenic
1051186688 9:14467794-14467816 CAAATCAAATGTAAGATGTTTGG - Intergenic
1052535860 9:29746175-29746197 CTGCTCTAATGTAAGCTTCTTGG + Intergenic
1055021284 9:71672977-71672999 CTATACTAATGTAAGATGTTAGG + Intergenic
1196648916 X:118148731-118148753 CTGCTACCAAGTAAGATTTTGGG + Intergenic
1198266609 X:135015124-135015146 ATGCTCCAAAATAACATGTTGGG + Intergenic
1198320743 X:135516638-135516660 CTGCTCCCATGAAAGATGGCAGG + Intergenic