ID: 962732710

View in Genome Browser
Species Human (GRCh38)
Location 3:138298664-138298686
Sequence CCTAAGGAGAAGAGGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 441}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962732710 Original CRISPR CCTAAGGAGAAGAGGATGGA GGG (reversed) Intronic
900055883 1:630372-630394 CCTAGGGAGAGGAGGGTGGATGG - Intergenic
901640940 1:10692704-10692726 CCTGAGGGGATGAGGATGGGTGG - Intronic
902091138 1:13904151-13904173 GCAAGGGAGCAGAGGATGGAGGG + Intergenic
902434039 1:16385687-16385709 CCCAAGGAGGAGAGCAGGGAAGG - Intronic
902608829 1:17585249-17585271 GCTTAGTAGAAGAGTATGGAGGG + Intronic
902660217 1:17895721-17895743 CCAAAGGAGAAGGGGATGGTGGG + Intergenic
902922107 1:19672219-19672241 CTGAAGGAGAGAAGGATGGATGG - Intronic
904224160 1:29000881-29000903 TCTAAGAAGCAGAGCATGGAAGG + Intronic
904575415 1:31502172-31502194 CCTTGGGAGAAGAGGATGCCAGG - Intergenic
905295464 1:36951750-36951772 GAGAAGGAGAAGAGGATGAAAGG + Intronic
905405285 1:37728352-37728374 CCTAAGAAGAAAAGGAATGAGGG + Intronic
906560243 1:46751226-46751248 GCAAAGGAGAAGAGGATTGAAGG - Intergenic
907072477 1:51549227-51549249 CCAAAGGAGAAGGGGATGTGTGG - Intergenic
907108583 1:51906164-51906186 CCTCAGGATATGGGGATGGAAGG - Intergenic
908512611 1:64861361-64861383 CCTGTGGAGAAGAGGAGGGAGGG + Intronic
908565150 1:65346623-65346645 CCTAAGCAGATGAGGAAGGGTGG - Intronic
908951634 1:69568508-69568530 TCGGAGGAGAAGAGGAGGGAAGG - Intronic
909041189 1:70654198-70654220 CCCAAGAAGAAGAGGAAAGAAGG + Intergenic
909287256 1:73836081-73836103 CCTAAGGAGAAGAAGAGAGAAGG + Intergenic
910992201 1:93067849-93067871 CAAAAAGAGAAGAGGATGGATGG - Intergenic
911299198 1:96152056-96152078 CTTAAGGACAAGAAGATAGATGG + Intergenic
912067519 1:105762888-105762910 TCTACGGAGGAGAGGATGTATGG + Intergenic
912739910 1:112184691-112184713 TGTTAGGAGAAGAAGATGGAGGG + Intergenic
912762810 1:112384122-112384144 TCTACGGAGAACAGGCTGGAGGG + Intergenic
913057776 1:115178214-115178236 CAGAAGGAGAAAAGGAAGGAAGG - Intergenic
913556364 1:119971303-119971325 AGTTAGGAGAAGAGCATGGAAGG - Intronic
915626510 1:157117404-157117426 ACCAGGGAGAGGAGGATGGAAGG - Intergenic
917650248 1:177069363-177069385 GCAAAGGAGAAGCGGGTGGATGG - Intronic
919019040 1:192079886-192079908 GCTAAGGAGAAGTGGTTGGCAGG - Intergenic
920024438 1:202982963-202982985 CCCAAGGAGAAGGAGAGGGATGG + Intergenic
920081466 1:203376925-203376947 CCCAAGGAGAAGAAGAGAGATGG + Intergenic
920142109 1:203823947-203823969 CCTAAGGTGAAGAGCAAGGTGGG + Intronic
920200523 1:204257313-204257335 CCTCAGGGGATGAGGAAGGAAGG + Intronic
920219203 1:204383941-204383963 CAGGAGGAGATGAGGATGGAGGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920425365 1:205870826-205870848 CTTCAGGACAAGAGGATAGATGG - Intergenic
921270595 1:213465940-213465962 TCTAAGAAGAAGAGCAAGGATGG - Intergenic
921324560 1:213978039-213978061 TCTAAGGAAGAGAAGATGGAAGG + Intergenic
921650394 1:217671586-217671608 CAGAAGGAGAAGAGAAAGGAAGG - Intronic
921956753 1:220993047-220993069 AATGAGGAGAACAGGATGGAGGG - Intergenic
922197846 1:223375369-223375391 CCAAGGGAGAAGACCATGGAGGG + Intergenic
923300462 1:232635513-232635535 AGGAAGGAGAAGAGGAGGGAAGG + Intergenic
923522363 1:234745320-234745342 CCTGAGGAAAAGGGGAGGGAAGG + Intergenic
924184587 1:241474931-241474953 CTTAGGGGGAAGAAGATGGAAGG - Intergenic
924490950 1:244536794-244536816 CCTATGGAGAAGAAGATTGGTGG + Intronic
1063159296 10:3408199-3408221 CCTCAGGAGCAGAGGATGCAGGG + Intergenic
1063693071 10:8305702-8305724 AATAAGAAGGAGAGGATGGAGGG - Intergenic
1064476481 10:15695646-15695668 CATAAAGAGAAGAGACTGGAAGG - Intronic
1064577472 10:16760828-16760850 AGTATGGAGAAGAGGGTGGAGGG - Intronic
1064937952 10:20700661-20700683 ACAAAGGAAAAGAGGATGGGAGG - Intergenic
1065495385 10:26322083-26322105 CTTCAGGAGTAGAAGATGGATGG + Intergenic
1068650674 10:59519242-59519264 CCTAAGGCTGAGAAGATGGAGGG - Intergenic
1069616387 10:69809019-69809041 CCTTGGGAGTAGAGGATGGGAGG - Intronic
1071728460 10:88223167-88223189 CCTGAAGAGAACAGGATAGAAGG - Intergenic
1072411004 10:95202028-95202050 CCAAAGGAGAAGAGGACAAATGG + Exonic
1072593248 10:96846833-96846855 CCTAAGGAGAAGGGGACCAAAGG - Intronic
1072918164 10:99553160-99553182 GCTAAGGTGAGGAGGATGGAAGG - Intergenic
1073321236 10:102617479-102617501 CCAAGGGAGAAGAGGAGGGGTGG - Intronic
1075609156 10:123837268-123837290 GCTAATGAGAGGAAGATGGATGG - Intronic
1075668756 10:124248785-124248807 CCCAAGGTGAAGAGGCTAGAAGG + Intergenic
1076097541 10:127744306-127744328 CCATAGGAGAAGAGGCAGGAAGG - Intergenic
1076437978 10:130459547-130459569 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1076438039 10:130459806-130459828 CCTAAGGTGAAGAGGGAGGGGGG + Intergenic
1077505265 11:2927222-2927244 CTTTAGGCGAAGAGGGTGGATGG - Intergenic
1078360104 11:10661338-10661360 CCTGAGGTGAAGAGGAGGAATGG - Intronic
1078434533 11:11313435-11313457 CCTAAGGAGAAGAGTATGCCTGG + Intronic
1078495290 11:11811310-11811332 CCCGAGGAGCAGAGAATGGAAGG - Intergenic
1078950406 11:16125704-16125726 CCCAAAGAGAAGTGGAAGGATGG + Intronic
1080159844 11:29160359-29160381 CAAAAGCAGAAGAGGAGGGAGGG + Intergenic
1080461971 11:32462604-32462626 GGGAAGGAGAAAAGGATGGAGGG + Intergenic
1081009740 11:37795463-37795485 GCTAAGGAGAGCAGGATGAAGGG + Intergenic
1081664503 11:44908871-44908893 CCTAAGGAAGAAAGGATAGAAGG - Intronic
1082215935 11:49569437-49569459 CCCAAGGAGGAATGGATGGAGGG + Intergenic
1082225121 11:49696598-49696620 ACTATGGAGAACAGTATGGAGGG - Intergenic
1082870709 11:57942066-57942088 ACTAAGCAGCACAGGATGGAAGG - Intergenic
1084265910 11:68005002-68005024 CCTAAAGAGCAGTGGGTGGAGGG - Intergenic
1084518811 11:69650559-69650581 CCTGAGCGGGAGAGGATGGAGGG + Intronic
1084648533 11:70474632-70474654 CCTAGGGACAATAGGATGAATGG - Intronic
1085287076 11:75370039-75370061 TCTCAGGAGAAGAGGAAGGAGGG - Intergenic
1086034548 11:82400830-82400852 CCTAAGGAGGGGGGCATGGAGGG + Intergenic
1086450528 11:86911469-86911491 CCAAAAGGGAGGAGGATGGAAGG - Intronic
1086593702 11:88545551-88545573 CTCAAGGAGAAGAGGTTTGAAGG - Intronic
1086633645 11:89055037-89055059 CCCAAGGAGGAATGGATGGAAGG - Intronic
1087692790 11:101340993-101341015 CCTCAGGAGAAGAGGATCCTTGG + Intergenic
1087885771 11:103480678-103480700 CAAAAACAGAAGAGGATGGAGGG + Intergenic
1088323705 11:108580480-108580502 ACTATGGAGAACAGTATGGAAGG + Intronic
1088719269 11:112577425-112577447 CGTAAGGTGAAGAGGAGGCATGG + Intergenic
1089523503 11:119081436-119081458 CTGCAGGAGAAGAGGAGGGAAGG - Intronic
1090188353 11:124752370-124752392 CTTGGGGAGAAGAGGAAGGAAGG - Intergenic
1090605293 11:128416766-128416788 TCTCAGGAGATGAGGAAGGAAGG + Intergenic
1091984041 12:4893258-4893280 CCTGAAGACAACAGGATGGATGG - Intergenic
1092780899 12:11985893-11985915 CCTATGGAGAAGAGGTGGGTAGG - Intergenic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1093140365 12:15503301-15503323 AATAAGCAGCAGAGGATGGATGG + Intronic
1093429324 12:19066127-19066149 TCTATGGAGAAGAGCATGAATGG + Intergenic
1093917832 12:24825362-24825384 ACTATGGAGAACAGTATGGAGGG - Intronic
1094057560 12:26282464-26282486 CTGAAGTAAAAGAGGATGGATGG - Intronic
1094791880 12:33924804-33924826 CATGAGGAGAGGAGGATGTAGGG + Intergenic
1095342604 12:41109454-41109476 CTTAATGAGAAGTGGATGCAGGG - Intergenic
1095666987 12:44814140-44814162 CCTCAGGAGGAGCAGATGGAGGG + Intronic
1095943652 12:47741405-47741427 CCCAGGGAGAAGAGGGAGGAGGG - Intronic
1096742796 12:53706393-53706415 ACTCAGGAGAACAGCATGGAAGG - Intergenic
1097181266 12:57173345-57173367 ACTCAGGTGAAGAGGATGGTTGG + Exonic
1098166291 12:67702065-67702087 TCTAAGTAGAAGAGGAAGGTGGG - Intergenic
1098203050 12:68077476-68077498 CTTAAGCTGAAGAAGATGGAAGG + Intergenic
1098581200 12:72101332-72101354 TCTAAGGAGAACAGCATGAAAGG + Intronic
1099509253 12:83513045-83513067 GGTATAGAGAAGAGGATGGATGG + Intergenic
1099752102 12:86788404-86788426 CCCAAGGAGAAAAAAATGGAAGG + Intronic
1099833220 12:87872799-87872821 CCTAATGAGATGAAAATGGATGG - Intergenic
1100092616 12:90989820-90989842 CCTAAGGAGATGATGGTGAATGG - Intronic
1100368915 12:93947218-93947240 CATAAGGGGGAGAGGAGGGATGG - Intergenic
1100663084 12:96721890-96721912 TATAAGGAGTAGAGGTTGGAGGG + Intronic
1100756748 12:97759575-97759597 CCTAAGGAAAAGAGAAGTGAGGG + Intergenic
1100854567 12:98747527-98747549 ACTATGGAGAATAGCATGGAGGG + Intronic
1101238887 12:102818270-102818292 CCTACTGAGGAGAGGATAGAGGG - Intergenic
1101603625 12:106231720-106231742 CCCTAGGAGAAGTGGAGGGAGGG + Intergenic
1101860947 12:108481973-108481995 CCCAAGGAGAAGAGGGAGGTGGG + Intergenic
1102175422 12:110870581-110870603 CAGATGGAGCAGAGGATGGAGGG - Intronic
1103769611 12:123311307-123311329 CCTAAGAAGGTGAGAATGGAAGG + Intronic
1103860997 12:124013802-124013824 CCTTATGAGAAGTGGATGGTAGG + Exonic
1104235413 12:126930879-126930901 CCTATAGACAAGATGATGGAGGG + Intergenic
1104526864 12:129532252-129532274 CCTAGGCAGACGAGGATGGTGGG + Intronic
1104901693 12:132192802-132192824 TCTAAGGAGAAGAGAATGGTTGG + Intergenic
1105496501 13:20935287-20935309 CCAAAGGGGGAGAGGATGGGAGG + Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1105968401 13:25405197-25405219 CAGAAGGAGAAGAGGAGGGAAGG + Intronic
1106132768 13:26953247-26953269 CTTAAGGAGAAGGGAAGGGAGGG + Intergenic
1108418116 13:50221595-50221617 CCTTTGGTGAAGAGGAGGGATGG + Intronic
1108942282 13:55971640-55971662 CCTAGGGAGAGGAGGGTGGATGG + Intergenic
1109046076 13:57412368-57412390 TATAAGGAAAACAGGATGGAAGG + Intergenic
1109162129 13:58988663-58988685 CTTATGGTGAAGAGGATGGAAGG - Intergenic
1110122905 13:71905362-71905384 CCTTAGGAGGAGAGGAAGAAAGG - Intergenic
1111021695 13:82459313-82459335 CTTCAGGAGAGGAGGATAGATGG + Intergenic
1111533824 13:89575713-89575735 ACTGAGGAGAGGAGGAAGGAGGG - Intergenic
1111847855 13:93534146-93534168 CCTCAGGAGAATGGAATGGAAGG + Intronic
1112441487 13:99427315-99427337 AGGAGGGAGAAGAGGATGGAAGG + Intergenic
1113305704 13:109076275-109076297 CCTAAGAAGAAGAAGAAGGAAGG - Intronic
1114409807 14:22490036-22490058 CCTCAGGAGCAGAGAATGGAGGG + Intergenic
1115410270 14:33066280-33066302 CCAGCGGAGATGAGGATGGAAGG + Intronic
1115492322 14:33969355-33969377 CTTAAGGAGAACAGGGTGGAGGG + Intronic
1118729042 14:68653928-68653950 CAAAAGGAGATGAGGATGAATGG + Intronic
1119326274 14:73761251-73761273 CTCAGGGAGAAGAGGAGGGAGGG + Intronic
1121512842 14:94525426-94525448 GAAAAGGAGAAGAGGAAGGAAGG + Intergenic
1121882169 14:97510606-97510628 CCTAAGGGGAGAAGGAAGGAAGG - Intergenic
1122406291 14:101503150-101503172 CCTAGGGAGACGAGGCTGGCAGG - Intergenic
1122410345 14:101522545-101522567 TCGAAGGAGAGCAGGATGGAAGG + Intergenic
1122572998 14:102720777-102720799 CCCAAGGAGGAGGGGACGGAGGG - Intronic
1122733879 14:103823424-103823446 TCAAAGGAGAAGGGGAGGGATGG + Intronic
1125332296 15:38594102-38594124 TCTAAAGAGAAAAGGATGGGGGG + Intergenic
1127309404 15:57739171-57739193 CCCAAGGAGGAAAGGATGGAAGG - Intronic
1128292367 15:66487796-66487818 CCCCAGCAGTAGAGGATGGATGG - Intronic
1128776121 15:70321829-70321851 TCTATGGGGATGAGGATGGAAGG + Intergenic
1128804514 15:70520791-70520813 CATGAGGAGAAGGGGATGGTGGG + Intergenic
1128818854 15:70634325-70634347 CTTAAGGAGAAGCAGCTGGAGGG + Intergenic
1128868826 15:71136804-71136826 CCTGAGGAGAAGGGGCAGGAAGG + Intronic
1129889059 15:79059099-79059121 GGAAAGGAGAGGAGGATGGAGGG - Intronic
1130176661 15:81578874-81578896 CCTCAGGAGAAAGAGATGGATGG + Intergenic
1131036503 15:89225985-89226007 CCAAAGAGGAAGAGGATGGTGGG - Intergenic
1131415203 15:92249814-92249836 ACTATGGAGAACAGGTTGGATGG - Intergenic
1131756571 15:95570054-95570076 CCTAAGGAGAAGGAGAAAGATGG + Intergenic
1131852290 15:96555840-96555862 ACTAAGGAGCAGAGGAAGGGAGG + Intergenic
1131888970 15:96951765-96951787 CATTAGGAGAGAAGGATGGATGG - Intergenic
1132292549 15:100713673-100713695 CCTAGGGAGAGGAGCATGGTGGG - Intergenic
1133318743 16:4900081-4900103 ACTAAGGAGCAGAGGAAGCATGG + Intronic
1133483960 16:6200252-6200274 CCTAATGACAAGAGGGTGGACGG + Intronic
1133663203 16:7939100-7939122 CTTCAGTAGCAGAGGATGGAAGG + Intergenic
1134795809 16:17035770-17035792 ACTAAGGAGAGGAGGAGGGGAGG + Intergenic
1136095839 16:27955871-27955893 CCATAAGAGAAGAGGAAGGAAGG + Intronic
1136133232 16:28238026-28238048 CCTAAGGAGAAGGGGGAGAATGG - Intergenic
1138385211 16:56632027-56632049 TCTCAGGCGAAGAGAATGGACGG + Intergenic
1138387041 16:56643053-56643075 CCTCAGGAGTGGAGAATGGAAGG + Intronic
1138415367 16:56868382-56868404 CCTCTGGGGAAGAGGAGGGAGGG + Intronic
1138830970 16:60374297-60374319 AAAAAGGAGAAGAGGATGGGAGG - Intergenic
1139421710 16:66853254-66853276 CCTAAGGGAAGGAGGAGGGAGGG + Intronic
1139972317 16:70783775-70783797 CCAGGGGAGAAGGGGATGGATGG + Intronic
1140591011 16:76352692-76352714 AATAAGTAGAGGAGGATGGATGG + Intronic
1142442130 16:90105775-90105797 GCTAAAGAGGAGAGAATGGAAGG + Intergenic
1143167125 17:4902326-4902348 CCTAAGGGGTGGGGGATGGAAGG + Exonic
1143457731 17:7078587-7078609 CCTAGTGTGAAGAGGATGCAAGG - Intronic
1143729521 17:8873143-8873165 CCTCTGGGGAAGAGGAGGGAGGG - Intergenic
1144010726 17:11146342-11146364 CACAAGGAGTAGAGGAAGGAAGG - Intergenic
1144690438 17:17258966-17258988 CCTAAGGAGAAGAGGAAGGAAGG - Intronic
1144772796 17:17769272-17769294 CCAGAGTAGAAGTGGATGGATGG + Intronic
1145918065 17:28588353-28588375 CTTCAGGGGAAGAGGATGCATGG + Intronic
1146395383 17:32460942-32460964 AGTAAGGTGAAGAGGAGGGAAGG + Intronic
1147886592 17:43688439-43688461 ATTAAGGATATGAGGATGGAGGG - Intergenic
1148688472 17:49513515-49513537 CCTAAGATGAAGAGGATCGGAGG + Exonic
1151288809 17:73133580-73133602 CTGATGGAGAAGAGGCTGGAGGG - Intergenic
1151761348 17:76104869-76104891 CCTAAGGAGAGAAGGAGAGAAGG + Intronic
1152275330 17:79353284-79353306 CCCATGGAGGAGAGGATGGGAGG - Intronic
1153874629 18:9358178-9358200 CACAAGGAGAAGAGAAGGGAGGG - Intronic
1155384726 18:25265287-25265309 CCAAAGTAGAAGAGGAAGAAAGG + Intronic
1156295446 18:35785341-35785363 CCTGAGGAAATGAGGAAGGATGG - Intergenic
1156987094 18:43361398-43361420 CTTAAGGAGAAGGGGTGGGAGGG - Intergenic
1157519280 18:48334286-48334308 CCAAAGGAGAACAGGAGGCAAGG + Intronic
1158245133 18:55423870-55423892 TGTAAAGAGAGGAGGATGGAAGG + Intronic
1158448032 18:57537957-57537979 CATAAGGTGAAGTGGAAGGAAGG - Intergenic
1159980182 18:74768952-74768974 CCCAAAGACAAGAGGAAGGATGG - Intronic
1161139973 19:2641434-2641456 CCTCAGGAGAAGAGGCAGGAGGG + Intronic
1161895457 19:7076186-7076208 CCTAAGGAGACAAGCATTGAGGG + Intronic
1162174529 19:8821526-8821548 CCTAAGGAGACAAGCATTGAGGG - Intronic
1162776993 19:12985897-12985919 CCTATGGAGGGGAAGATGGAGGG - Intergenic
1163631752 19:18421107-18421129 CCTAGGCAGAAGAGGCAGGATGG - Intronic
1164458253 19:28426898-28426920 CCTAAGGACAGGAGGGTGGGAGG + Intergenic
1165403611 19:35617265-35617287 GCTAGGGAGAAGAGGAGGAAGGG - Exonic
1166076321 19:40415659-40415681 GCTAAGGAAAAAAGGAGGGAAGG + Intergenic
1166146852 19:40843977-40843999 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166151013 19:40875874-40875896 CCTGAGGAGGAGAGGCGGGAGGG + Exonic
1166155508 19:40908653-40908675 CCTGAGGAGGAGAGGCGGGAGGG + Intergenic
1166179308 19:41095738-41095760 CCTGAGGAGGAGAGGCAGGAGGG - Exonic
1166666125 19:44681454-44681476 CCTAAGGAAAAGAGACTGGAAGG + Intronic
1167128099 19:47565460-47565482 GCTAAAAAGAAGAGGATGGAGGG + Intergenic
925221014 2:2141081-2141103 CCCATGGAGAAGTGTATGGATGG + Intronic
925234451 2:2265863-2265885 CCTAAGGAGGCATGGATGGAGGG + Intronic
925632454 2:5908793-5908815 CTCAGGGAGAAGAGGGTGGAGGG + Intergenic
926250582 2:11153467-11153489 CAGAAGGGGAAGAGGAGGGAGGG + Intergenic
927524406 2:23723687-23723709 ACTATGGAGAACAGTATGGAGGG + Intergenic
927642646 2:24855192-24855214 CCTAAGAAGAAGGGGGTGGGGGG - Intronic
929127182 2:38532754-38532776 GCTGTGGAGAAGAGGATGGGAGG - Intergenic
930413562 2:51058920-51058942 CCTAAGAATAAGAAGATGAATGG + Intergenic
930695016 2:54402513-54402535 CCAAAGGAGAGGAGGAAGAAGGG + Intergenic
931166638 2:59755997-59756019 CACAAGGAGATGAGAATGGAAGG + Intergenic
931247005 2:60500051-60500073 CGAAAGGAGGAGAGGAGGGAGGG - Intronic
932132779 2:69202594-69202616 TCTTAGGAGAAGGGGTTGGAGGG + Intronic
933982063 2:87558681-87558703 GTTAAGGAGAAGAGTATGGAAGG - Intergenic
934025368 2:87997950-87997972 CCTAAGGAAAAGAGACTAGAAGG - Intergenic
934876844 2:97929594-97929616 ACTAAGGAGAAAAGGATGCTTGG - Intronic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
935548671 2:104428391-104428413 CTTAAGGAGCAGATGATGTAAGG + Intergenic
935575895 2:104710155-104710177 CCTTAAGAGAAGAGGGTGGGTGG - Intergenic
936311774 2:111392131-111392153 GTTAAGGAGAAGAGGATGGAAGG + Intergenic
937082922 2:119153353-119153375 CCTGAGGAGAGGAGACTGGAGGG + Intergenic
937563275 2:123251428-123251450 CCCAAGGAGAAGAAGAAAGATGG + Intergenic
937818486 2:126280425-126280447 GTGAAGGAGAAGAGGATGTATGG - Intergenic
938178842 2:129161834-129161856 CCAAAGCAGGAGAGGAGGGAGGG - Intergenic
938213004 2:129484386-129484408 CCTGAGGAGCAGGGGCTGGATGG - Intergenic
938246132 2:129779346-129779368 CCTCTGCAGATGAGGATGGAGGG - Intergenic
938920517 2:135990314-135990336 CCAAAAGAGTAGAGTATGGAGGG + Intergenic
939121949 2:138127612-138127634 AAGAAGGAGAAGAGGAAGGAAGG - Intergenic
939636402 2:144587942-144587964 ACTCAGGAGAAGAAGAAGGAAGG + Intergenic
941146558 2:161854081-161854103 ACTAAGGAGAAAAGGAATGAGGG + Intronic
941263695 2:163331900-163331922 CCTAAGGAGGAGAGTGTGGACGG + Intergenic
942017772 2:171833751-171833773 CAGAGGGAGAAGAAGATGGAGGG - Intronic
942737443 2:179131502-179131524 CCTAAGGAGAAGGGAATTAATGG + Intronic
944958353 2:204838548-204838570 TCAAAGAAGCAGAGGATGGAAGG + Intronic
947991281 2:234489480-234489502 TCTAGGAAGACGAGGATGGACGG - Intergenic
948438214 2:237967755-237967777 GCAAAGGAGACGAGGAAGGAAGG + Intronic
948624363 2:239259942-239259964 GCTAAGGAGAAGAGGATCTAAGG + Intronic
1169248975 20:4045953-4045975 TCTCAGGAGAAAGGGATGGAGGG - Intergenic
1169253089 20:4075127-4075149 CTGGAGGAGATGAGGATGGAGGG - Exonic
1170230270 20:14038519-14038541 ACAAAGGTGAAGAGGATAGAAGG - Intronic
1170335571 20:15267075-15267097 TCTAAGGACAAGAGCATGCAAGG + Intronic
1171036702 20:21718252-21718274 CCAAAGGAAAGGAGGATTGAGGG + Intronic
1171217771 20:23364576-23364598 CTTAATGAGAAGAGTGTGGATGG + Exonic
1172345439 20:34194896-34194918 AATAAGGAGATGAGGAAGGAGGG - Intronic
1172933167 20:38600532-38600554 GCTCAGGAGAAGTGGATGGGTGG + Intergenic
1173264374 20:41465875-41465897 CCTTTAGAGAACAGGATGGAAGG - Intronic
1173409698 20:42799145-42799167 GAAAAGGGGAAGAGGATGGATGG + Intronic
1173464663 20:43271499-43271521 CCTGAGGAGAAGTGGAGGGAGGG - Intergenic
1173649739 20:44655583-44655605 ACTAAGGTGCAGAGGCTGGAGGG - Intergenic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174180465 20:48671196-48671218 CCTAAGGAAAAGACCATGCAGGG + Intronic
1174414600 20:50358562-50358584 GCTCAGGAGAGGAGGCTGGAGGG - Intergenic
1174641765 20:52050442-52050464 CAGAAGGAGAAGAGGAAGAAGGG - Intergenic
1175076648 20:56380564-56380586 CTTAAGGAGTAGAGAGTGGATGG - Intronic
1175107714 20:56626747-56626769 CGCCTGGAGAAGAGGATGGAAGG - Intergenic
1175181280 20:57149292-57149314 CATAAGCAGAAAATGATGGAAGG + Intergenic
1176458275 21:6931844-6931866 TATAAGGAGAAGAGGAGAGAAGG + Intergenic
1176836449 21:13796938-13796960 TATAAGGAGAAGAGGAGAGAAGG + Intergenic
1176930080 21:14799312-14799334 GCTATGGAGAACAGTATGGAGGG - Intergenic
1177105955 21:16955840-16955862 CCTAAGGGGAAAGGGAGGGAGGG - Intergenic
1178076885 21:29020547-29020569 CCTCAAGAGAAGGGGAAGGATGG + Intergenic
1179637279 21:42721185-42721207 CCTAAGGAAGAGAGGAGGGCAGG + Intronic
1181064130 22:20297710-20297732 CCTGATGAGGAGAGGAAGGAGGG + Intergenic
1181520325 22:23444835-23444857 CCTAAGGAGAAGGAGAGAGATGG + Intergenic
1181929374 22:26387633-26387655 CGTAATGAGTAGAGGCTGGAAGG - Intergenic
1182015210 22:27033364-27033386 CTGAAATAGAAGAGGATGGATGG + Intergenic
1182075455 22:27492513-27492535 CCTAAGGGGAACAGTTTGGAAGG + Intergenic
1183229699 22:36574051-36574073 CCTAAGGAGAGGAGGCAGGCGGG + Intronic
1184250919 22:43259873-43259895 CCTGAGGAGAAGAGGCTGGAGGG - Intronic
1185313499 22:50169511-50169533 CCGAGGGAGAACAGGACGGAGGG + Intergenic
949347352 3:3089082-3089104 CCTAGGGAGGAGGGGAGGGAGGG + Intronic
950008867 3:9708292-9708314 CCAAAGGAGGGGAGGAAGGACGG + Intronic
950841237 3:15970184-15970206 CCCAAGGCGAAGAGGAAGGATGG - Intergenic
951805800 3:26642430-26642452 GGAAAGGAGAAGAGGATGAATGG + Intronic
952534552 3:34296051-34296073 TCTCAGGAGAAGGGGAGGGAAGG + Intergenic
952603323 3:35111537-35111559 CTTAAGTAGAAGAGGAGGGCTGG + Intergenic
953118506 3:40016126-40016148 TCCAAGGAGAAGAGGACAGAAGG - Intronic
953208391 3:40852342-40852364 GCAATGGAGGAGAGGATGGATGG + Intergenic
953233035 3:41081382-41081404 CCCAAGGAGATGAGAATGGAAGG - Intergenic
953571915 3:44077968-44077990 CCTAAGTAGAAGCCGATGGGAGG + Intergenic
954363997 3:50136794-50136816 TCTCAGGGGAAGAGGATGAAAGG + Intergenic
955202869 3:56866968-56866990 GCTAAAGACAAGAGGATAGAAGG - Intronic
955408201 3:58639201-58639223 GCGAAGGGGAAGAGGAGGGAAGG + Intronic
955467724 3:59253926-59253948 GGGAAGGAGAAGAGGAAGGAAGG - Intergenic
956087297 3:65625793-65625815 CCTAAGGAGATCTGGATGAAAGG + Intronic
957402416 3:79733623-79733645 CCTGAAGTGAAGAGGATGGTGGG - Intronic
958816262 3:98919562-98919584 CCTAAGGCAAAGAGAAAGGAAGG + Intergenic
959481448 3:106877402-106877424 AGTAAGAAGAAGAGGAAGGAAGG + Intergenic
959898525 3:111633196-111633218 CCCAAGGAGAGGAAGAGGGATGG + Intronic
960218028 3:115066702-115066724 CCACAGGAGATGAAGATGGAGGG - Intronic
960306021 3:116061622-116061644 GCTATGGAGAAAAGGAAGGAAGG - Intronic
960833508 3:121878955-121878977 ACTATGGAGAACAGTATGGAGGG - Intronic
961321422 3:126078973-126078995 CATCAGGAGAAGAGGAGGGGAGG - Intronic
962658389 3:137573158-137573180 CCTAAAGCAAACAGGATGGAAGG + Intergenic
962732710 3:138298664-138298686 CCTAAGGAGAAGAGGATGGAGGG - Intronic
962806040 3:138928587-138928609 CCTAAGGAGGAAAGCATGGCAGG - Intergenic
963009023 3:140752179-140752201 GCTAATGAGAAGAGGAGGGGTGG + Intergenic
963444528 3:145387273-145387295 CCTAAGCAGATGTAGATGGATGG - Intergenic
965759726 3:172062770-172062792 CAAAATGAGAAGAGGATGGATGG - Intronic
966342829 3:178944546-178944568 TCTAACCAGAAGAGTATGGATGG - Intergenic
966475730 3:180343578-180343600 ACTATGGAGAACAGTATGGAGGG - Intergenic
966703941 3:182889814-182889836 ACTAAGGTGAAGAGCATGCAGGG - Intronic
967337700 3:188362523-188362545 GCTAAGGAGTAAAGGATGGAAGG - Intronic
967526274 3:190497315-190497337 CCTAAAGCAAAGAGGATGGATGG + Intergenic
968362398 3:198156736-198156758 GCTAAAGAGTAGAGAATGGAAGG + Intergenic
968652243 4:1764879-1764901 CCCGAGGAGAGGAGGAGGGAGGG - Intergenic
969685213 4:8668397-8668419 CCTCAAAAGAAGAGAATGGAGGG + Intergenic
969696823 4:8739787-8739809 CCTAAGCATGAAAGGATGGAGGG + Intergenic
970056799 4:11983060-11983082 CCTCAGGAGAATCAGATGGAAGG - Intergenic
970231674 4:13917223-13917245 CCTAGAGAGAAGAGGTTGGAGGG - Intergenic
970313689 4:14809169-14809191 CCTAAGGAGGAAAGGAGAGAAGG + Intergenic
970578587 4:17452200-17452222 ACTGTGGAGAAGAGTATGGAGGG - Intergenic
971563066 4:28106129-28106151 TCTAAGGAGAAAAAGAAGGAAGG + Intergenic
972296495 4:37744182-37744204 CTTAAGTAGAAGAGAAGGGATGG + Intergenic
972730506 4:41789999-41790021 CTTAAGGAGGAGAAGAAGGAAGG - Intergenic
972828399 4:42787206-42787228 CCTAAGGGCAAGAGGAGCGAGGG + Intergenic
972845825 4:42987981-42988003 CCCAATGAGAAGAGCAAGGAGGG - Intronic
972970369 4:44567271-44567293 CAGAAGGAGAAGAGGAAGCAAGG - Intergenic
973582002 4:52353078-52353100 CCTAAGGAAAAAAGGAAGAAAGG - Intergenic
974352292 4:60764678-60764700 CCTAAGATGAAAAAGATGGAAGG - Intergenic
975407431 4:74006911-74006933 CCTCTGGAGAAGAGAATGAATGG - Intergenic
975906306 4:79216782-79216804 CCTAAGGAGTGGTGGATGGCTGG + Intergenic
976080948 4:81354122-81354144 CCTAAGAAGAAGAGGAAAGGGGG - Intergenic
976623325 4:87151561-87151583 CCTAGGGTGAAGAGAAAGGAGGG + Intergenic
977024660 4:91802129-91802151 CCTCAGGAGAAGGAGAGGGATGG - Intergenic
977887143 4:102265287-102265309 CCCAAGGAGAGGGAGATGGAAGG + Intronic
978536647 4:109770019-109770041 CCCCAGGCAAAGAGGATGGAAGG - Intronic
978627683 4:110705586-110705608 CCAAAGAAGAAGAGGAAGCAAGG - Intergenic
979647524 4:123088753-123088775 CTGAAGGAGAAGAGGAAGCAAGG - Intronic
980594745 4:134939244-134939266 CCTAAGGAGAGGAAGAGAGAAGG - Intergenic
981798748 4:148631033-148631055 CCAAAGGAGAAGGAGATGGTGGG + Intergenic
981993311 4:150950753-150950775 CATAAATGGAAGAGGATGGAAGG - Intronic
982142959 4:152346379-152346401 ACAAAGGAGAAGATGAAGGAAGG + Intronic
982240702 4:153296584-153296606 CCCAAGGAGAGGAGGAGGGGTGG + Intronic
982430921 4:155321190-155321212 TCTAAAGAGAACAAGATGGATGG - Intergenic
983065180 4:163201573-163201595 GTTAAGGAGAAGAGGAGTGAAGG + Intergenic
985518881 5:361395-361417 CCTAAGGAGAACAGGACGGGAGG + Intronic
985970891 5:3377571-3377593 CCTATGGAGATGAAGATGCAGGG + Intergenic
987772917 5:22330105-22330127 CTTAAGGAGAGGAGAATGAAGGG + Intronic
988792300 5:34619949-34619971 CCTAAGGAGGGGAGGAGAGAAGG + Intergenic
988952890 5:36282801-36282823 CACAAGGAGAAGAGGAATGATGG - Intronic
989183657 5:38602463-38602485 CTCAAAGAGAAGATGATGGAGGG - Intronic
989307761 5:39977284-39977306 CCTAAGGAGGACAGGGAGGATGG + Intergenic
989375064 5:40752550-40752572 CCCAAGGAGAAGAAGAGAGATGG + Intronic
989639234 5:43567100-43567122 AGTAAGGAGAAGGGGATGAAGGG - Intergenic
991527308 5:67575332-67575354 CATAAAGAGAGAAGGATGGAGGG - Intergenic
992548919 5:77843631-77843653 CCTAAGGAGTAGTGGGTAGACGG + Intronic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993764132 5:91834271-91834293 CCTAGGGATAAGAGGAAGGACGG - Intergenic
995849758 5:116532696-116532718 CCTAGGGAAAAGAGAAGGGAAGG - Intronic
996016766 5:118547713-118547735 CCTAAGGGGAAGAGGGGGCAGGG + Intergenic
997204145 5:132031775-132031797 CATGAGGGGAAGAGGTTGGATGG - Intergenic
997361514 5:133298302-133298324 CCTAAGGAGCAGAGCATTGCAGG - Intronic
997583609 5:135031922-135031944 CCTGAGGAGAAGAAAGTGGAGGG - Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
999157893 5:149471607-149471629 ACTAGAGAGAAGAGGAGGGAGGG + Intergenic
999230046 5:150056390-150056412 CCTGAGGTGAGGAGGATGGCAGG + Intronic
999384360 5:151143880-151143902 CCCAAGGAGTAGAGTAGGGAGGG + Intronic
999457734 5:151731872-151731894 ACTAAGGAAAAGGGGATGAAAGG + Intergenic
999544277 5:152609661-152609683 GCCAAGGAGATGGGGATGGAAGG + Intergenic
999802813 5:155053553-155053575 CAAGAGGAGAAGAGGATGGAGGG + Intergenic
1000230766 5:159313145-159313167 GCTCAAGAGAGGAGGATGGAAGG + Intergenic
1001090624 5:168737577-168737599 CCCAAGGAAAAGAGGGGGGAAGG - Intronic
1001384417 5:171326628-171326650 GCTAAGGAGAGAAGGCTGGAGGG + Intergenic
1001630177 5:173169074-173169096 GCTAAGAAGAAGAGGATGCTGGG + Intergenic
1001886752 5:175299076-175299098 CTTAAGGAGAAGGGTAAGGATGG + Intergenic
1002495830 5:179610724-179610746 CCTAAGCGGTATAGGATGGAGGG - Intergenic
1003171583 6:3725260-3725282 CCTGAGGACATGAGGAGGGAGGG + Intronic
1003443505 6:6164779-6164801 ACAGAGGAGAAAAGGATGGAGGG - Intronic
1003848353 6:10197055-10197077 CCTAAGGATAATTGGATGAAAGG - Intronic
1004919982 6:20367228-20367250 ATTGAGGAGAAGAGGAGGGAGGG + Intergenic
1006811307 6:36822192-36822214 CCTCAGGCCAAGAGGAAGGAGGG + Intronic
1006847982 6:37076475-37076497 CCTTAGGAGAAGCGGGTGAAGGG + Intergenic
1007828775 6:44622148-44622170 TCTAAGGAAAAAAGGAGGGAAGG - Intergenic
1007955317 6:45912739-45912761 CCTAAGGAGAAGAAGAATAAAGG + Intronic
1009515508 6:64611051-64611073 CCTAAAAAGCAGAGGATGCATGG - Intronic
1009942219 6:70302959-70302981 CCTATGAAGAAGGGGTTGGAAGG + Exonic
1011557684 6:88587161-88587183 ACTGATGAGAAGAGGAGGGAAGG - Intergenic
1012294428 6:97503291-97503313 GAGAAGGAGAGGAGGATGGAGGG + Intergenic
1012302989 6:97612820-97612842 ACTATGGAGAAGAGTTTGGAGGG - Intergenic
1013105966 6:107027126-107027148 CCTAATGAGAGAGGGATGGATGG + Intergenic
1013414214 6:109910210-109910232 CCTGAGAAGAACAGGAGGGAAGG - Intergenic
1013461087 6:110376266-110376288 ACTAAGGAAAATAGGAAGGAAGG + Intergenic
1013566634 6:111371100-111371122 CAGAAGCAGAAGAGGATGGCTGG - Intronic
1014125847 6:117776285-117776307 ACAAAGGAGAAGTGGAGGGAGGG - Intergenic
1014139724 6:117927464-117927486 GCTAAGAGGAAGAGGAGGGAAGG + Intronic
1014311704 6:119811886-119811908 CAGAAGGAGAAAAGAATGGAAGG - Intergenic
1015891045 6:137970009-137970031 ACCAAGAAGAAGATGATGGATGG + Intergenic
1015919488 6:138252612-138252634 CCCCAGGAGAAGGGGGTGGAAGG - Intronic
1016999024 6:149982783-149982805 CCTCAGGAGAGGATGATGCAGGG + Intergenic
1017209401 6:151838219-151838241 CCGAAGGAGCAGAAGAAGGATGG + Intronic
1018420253 6:163634854-163634876 CCTAAGGAGAAAGGGCTGCATGG - Intergenic
1018721142 6:166573361-166573383 CCTAGGTTGAAGAGGATGGCAGG + Intronic
1018944087 6:168333703-168333725 CCTCAAGAGAACAGCATGGAGGG + Intergenic
1019172735 6:170143304-170143326 CCTAAGGAGAATTGTATGGGAGG - Intergenic
1019253282 7:31971-31993 GCTAAAGAGTAGAGAATGGAAGG - Intergenic
1019590917 7:1831393-1831415 CCTAAGGAGAAGGAGAGAGATGG - Intronic
1019768832 7:2870773-2870795 CCAGAGGAGAAGAGGAAGGAAGG + Intergenic
1021789572 7:24190777-24190799 CCAATGGAGAAGAGCAAGGAGGG - Intergenic
1021824876 7:24539796-24539818 CCTATAGAGAAGAGTATGGCAGG - Intergenic
1022349886 7:29558060-29558082 CCTATGGAGAAGGGGGAGGAGGG + Intergenic
1023469696 7:40502021-40502043 ACTAAGAAGAAGATAATGGAGGG + Intronic
1024094748 7:45974682-45974704 CCTAGGGAGAAGAGCACCGAGGG - Intergenic
1024759906 7:52583176-52583198 ACTTAGGTGAAGAGGATGGCTGG - Intergenic
1024770071 7:52712353-52712375 ATTAAGAAGGAGAGGATGGAGGG + Intergenic
1027529841 7:79316648-79316670 CAAAATTAGAAGAGGATGGAGGG - Intronic
1028581361 7:92412930-92412952 CGTGCGGAGAAGAGGAAGGAGGG - Intergenic
1029529915 7:101118503-101118525 GGTAAAGAGAAGTGGATGGAGGG + Intergenic
1029581187 7:101437485-101437507 GCCAAGGAGAGGAGGAGGGATGG + Intronic
1029962301 7:104700868-104700890 GTTAGGGAGAAGAGGATGAAGGG - Intronic
1030828187 7:114187091-114187113 GATAAGGAGATGAGTATGGATGG - Intronic
1030858409 7:114590754-114590776 TCTAGGGAGAAGTGGATGAAGGG + Intronic
1030909896 7:115233897-115233919 GATAAGGGGAAGAGGATGAAAGG + Intergenic
1030948898 7:115764470-115764492 ACAAAGGAGAAAAGGATGAAAGG - Intergenic
1030975728 7:116120584-116120606 CCTATGGAGAAAATGATGCAGGG - Intronic
1032531317 7:132623023-132623045 CCAATGGAGAAGGGGCTGGAAGG - Intronic
1032971152 7:137165388-137165410 CCTGAGGAGAGAAGGATGTATGG - Intergenic
1034494365 7:151410804-151410826 CCTAGGGAGAAGGGCAAGGAAGG + Intergenic
1034991636 7:155551244-155551266 AGTAAGGAGAGGAGGAAGGAAGG - Intergenic
1035142565 7:156777365-156777387 GCTAAGGTGTAGAGGAGGGAAGG - Intronic
1035632929 8:1121768-1121790 TCTAAGGAGACAAGGATGGGTGG - Intergenic
1035642868 8:1197329-1197351 ACTGAGCAGAAGAGGAGGGAGGG - Intergenic
1035652682 8:1280731-1280753 TATAAGGATAAGAGGCTGGAAGG + Intergenic
1037262394 8:17023430-17023452 CCTAAGGAAGACAGCATGGAAGG + Intergenic
1037331376 8:17747169-17747191 AATAAGGTGAAGAGGATGGCAGG - Intronic
1038361237 8:26880434-26880456 CCTATGGGGAAGAGGATGATTGG - Intergenic
1038828261 8:31031779-31031801 CATAAAGAAAAGAGAATGGATGG - Exonic
1038922432 8:32099565-32099587 CTTAAGAAGAATAGGAAGGATGG + Intronic
1041216150 8:55602794-55602816 TGTAAGAAGAAAAGGATGGAAGG + Intergenic
1042392826 8:68255800-68255822 GCTAAATAGAAAAGGATGGAAGG + Intergenic
1042606724 8:70553317-70553339 CCTAAGGTCAAGAGGATTGGGGG - Intergenic
1042651349 8:71045575-71045597 CCCGGGGAGAAGAGGATGGGAGG + Intergenic
1042859136 8:73295374-73295396 CCCAAGGAGAAGAGCGTGGCGGG + Exonic
1043671468 8:82890400-82890422 CTTAAAAAGAAGAAGATGGAGGG - Intergenic
1045178196 8:99749809-99749831 ACTATGGAGAACAGTATGGAGGG - Intronic
1045406826 8:101874858-101874880 CCTAAGTAGAACAGGAGGGAGGG + Intronic
1046347074 8:112944153-112944175 TATAAGGAGATGAGGATGGATGG - Intronic
1046935559 8:119882278-119882300 CCTCAAGAGAAGAGAATGCAAGG + Intronic
1047037222 8:120953282-120953304 CCCAAGGAGAAGAGGATGAGGGG + Intergenic
1047338295 8:123956517-123956539 CCTACTGCGAAGATGATGGAGGG - Intronic
1048994041 8:139778817-139778839 CTGAAGGAGAAGAGAGTGGAGGG + Intronic
1049443537 8:142619771-142619793 CAACAGGAGAAGAGGAAGGAAGG - Intergenic
1049633833 8:143674980-143675002 CCTAAGGAGAGCAGCATGGCGGG + Intergenic
1050998690 9:12252959-12252981 GCTAAGGAGAAAAGCATGCAGGG + Intergenic
1051072146 9:13183417-13183439 CCTTAGGAGGAGATGATGGAAGG + Exonic
1051228143 9:14924394-14924416 CCTAAGGAAAGGAGGAGAGAAGG - Intergenic
1051348584 9:16175723-16175745 CATTGGCAGAAGAGGATGGATGG + Intergenic
1051700908 9:19822935-19822957 GAGAAGGAGAAGAGGAAGGAAGG - Intergenic
1051734498 9:20184673-20184695 CATATGGAGAACAGTATGGAGGG + Intergenic
1052474524 9:28941840-28941862 CAAAAGAAGATGAGGATGGATGG + Intergenic
1052930017 9:34048615-34048637 CGTGAGGGGAAGAGGAAGGAGGG + Intronic
1055865810 9:80811871-80811893 CCTAAGGAGAACAGCAGGTAGGG - Intergenic
1055867001 9:80826875-80826897 TCTAAGGTGAAGAGGAATGAAGG + Intergenic
1057482445 9:95456076-95456098 GCTAAGGAGAGGGGTATGGAAGG - Intronic
1057774254 9:97993102-97993124 CCTAAAGAAAAGTGGAAGGAAGG + Intronic
1058341687 9:103904881-103904903 TGGAAGGAGAAAAGGATGGAAGG + Intergenic
1060290153 9:122294902-122294924 TTTTAGGAGAAAAGGATGGAGGG + Intronic
1060818411 9:126647929-126647951 CCTGGGGACAGGAGGATGGAGGG - Intronic
1060947598 9:127579285-127579307 CCTAAAGGGGAGAGGAAGGAGGG - Intergenic
1062747087 9:138220398-138220420 GCTAAAGAGTAGAGAATGGAAGG + Intergenic
1202629531 M:5202-5224 CCTAGGGAGAGGAGGGTGGATGG - Intergenic
1185870491 X:3660865-3660887 TCAAATGAGAAGAGGAGGGAAGG + Intronic
1186447536 X:9644386-9644408 CCAGAGGAGGAGAGGATGAAAGG + Intronic
1186460616 X:9745701-9745723 CAGAAGGAGAAGAGAAGGGAGGG - Intronic
1186546075 X:10451182-10451204 CATAAGCAGGAGAGGATGGACGG - Intronic
1186731507 X:12415375-12415397 ACTGGGGAGGAGAGGATGGATGG - Intronic
1187195349 X:17078082-17078104 CCTAAGGAATAGAAGATGGGAGG + Intronic
1188711047 X:33398321-33398343 TGTAAGGAGAAGAGGGAGGAGGG + Intergenic
1190725803 X:53189887-53189909 ACTAAGGAGAAGGGGAAGAAGGG + Intergenic
1192560192 X:72123256-72123278 GCTAAGTAGAAGAGGAAAGAAGG + Intergenic
1194328379 X:92550086-92550108 CGTAGGGAGAAGAGGAGAGAGGG - Intronic
1199520457 X:148729421-148729443 GCAAAGGAGATGAGGCTGGATGG + Intronic
1200223139 X:154401916-154401938 TCTTTGGAGAGGAGGATGGAAGG + Exonic
1200793553 Y:7320278-7320300 TCAAATGAGAAGAGGAGGGAAGG - Intergenic
1201553004 Y:15238471-15238493 CACAAGGAGAAGAAGAGGGAAGG - Intergenic