ID: 962733120

View in Genome Browser
Species Human (GRCh38)
Location 3:138300909-138300931
Sequence TGCCTCGGCATCAGTGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962733120 Original CRISPR TGCCTCGGCATCAGTGTGCC TGG Intronic
903943306 1:26946296-26946318 TGCCCCGGGACCTGTGTGCCTGG - Exonic
904119781 1:28190218-28190240 TGCCTGGGCCTCAGAGTGCTGGG + Intronic
904433184 1:30478383-30478405 TGCCTGGGCCTCTTTGTGCCTGG + Intergenic
905266053 1:36755164-36755186 AGCCTGGGCATGAGGGTGCCTGG + Intergenic
905446793 1:38032863-38032885 TGCCTCTGCATGTGTGTGCATGG + Intergenic
907389913 1:54151523-54151545 ACCCTGGACATCAGTGTGCCTGG - Intronic
909038999 1:70628238-70628260 TCCCTGGGCATGAGTGAGCCTGG - Intergenic
910260862 1:85292586-85292608 TGCCTGGGCATCAAGGAGCCTGG - Intergenic
915390581 1:155539781-155539803 TGCCTTGGCCTCAATGTGCTGGG - Intronic
916172273 1:162010098-162010120 TCCCTCTTCTTCAGTGTGCCAGG - Intronic
918747707 1:188227222-188227244 TCCCTCAGCTTTAGTGTGCCTGG + Intergenic
919990948 1:202708615-202708637 TCCCTAGGCTGCAGTGTGCCTGG + Intronic
920007153 1:202841759-202841781 TGCCTCGGCCTCAAAGTGCTGGG - Intergenic
920539133 1:206764288-206764310 TGGGTGGGCCTCAGTGTGCCTGG - Intergenic
921315210 1:213884004-213884026 TGCCTCGTGCTGAGTGTGCCTGG + Intergenic
921655439 1:217730329-217730351 TGCCTCAGCCTCAGAGTACCTGG + Intronic
1065338741 10:24682845-24682867 TGCCTCGGCCTCAAAGTGCTGGG - Intronic
1067995914 10:51273087-51273109 TGCCTCTGCATCACTGGGCATGG + Intronic
1069947329 10:71997002-71997024 TGCCTCGGCCTCACCGTGCCTGG + Intronic
1073951700 10:108816689-108816711 TCCCTCGGAATCAGTTTCCCTGG - Intergenic
1076005174 10:126943137-126943159 TGCCTCTGCCTCAGTGTAGCTGG - Intronic
1076049072 10:127318358-127318380 TGCCTCTCCTTCAGTGTGCTGGG - Intronic
1076414058 10:130272345-130272367 TGTCTCAGCCTCACTGTGCCCGG + Intergenic
1076571726 10:131437730-131437752 TGCCTCTGACTCACTGTGCCTGG + Intergenic
1076857118 10:133122801-133122823 TGCCTGGGGATGCGTGTGCCTGG - Intronic
1079099347 11:17531230-17531252 GGCCTCGGCCTGAGTGTGCGTGG - Exonic
1079218181 11:18533900-18533922 TGCCTCGGCCTCCGAGTGCTGGG + Intronic
1083326881 11:61877466-61877488 TGCCACGGCAGCCGTATGCCCGG + Intronic
1084904497 11:72335243-72335265 TCCCTCAGCACCAGTGAGCCAGG - Intronic
1090760820 11:129835635-129835657 TGCCCCTGAATCTGTGTGCCTGG - Intronic
1094816367 12:34189978-34190000 TTCTTCAGCAGCAGTGTGCCTGG + Intergenic
1095616058 12:44190437-44190459 AGGCTCGGCAACTGTGTGCCAGG + Intronic
1097248301 12:57618787-57618809 TGCCTCGGCCTCAAAGTGCTGGG + Intronic
1100403700 12:94254137-94254159 TTCCTCAGCATCTCTGTGCCTGG - Intronic
1104614188 12:130254818-130254840 TGACTCGGCATCAGGGCTCCTGG + Intergenic
1105630687 13:22162549-22162571 TGCCTCAGCATCTGAGTGGCTGG - Intergenic
1106466188 13:30016440-30016462 ACCCTCGACATCAGAGTGCCCGG + Intergenic
1125521095 15:40348252-40348274 TGCCTCTGAATCACTGTGGCTGG + Intergenic
1125564256 15:40663305-40663327 TGCCTCGGCTTCAAAGTGCTGGG + Exonic
1125787469 15:42333560-42333582 GGCTTAGGCATCAGAGTGCCTGG + Intronic
1127911494 15:63419841-63419863 TGCCTGGGCCTCAGTGGGCCTGG - Intergenic
1128998723 15:72316093-72316115 TGCCTGGGGACCAGTGTCCCAGG + Intronic
1133592938 16:7263645-7263667 TGCCTCGGCCTCTCTGTGCTGGG - Intronic
1134875740 16:17697125-17697147 TGCCTCTGCCACAGTGTGTCTGG - Intergenic
1136168007 16:28469736-28469758 TGCCTCGGCCTCCCAGTGCCGGG - Intronic
1142225474 16:88875177-88875199 TGGCTTGGCATCTGTGTGCGTGG - Exonic
1143078150 17:4363006-4363028 TGCCTCGGCCTCAGAGTTGCTGG - Intronic
1144077980 17:11735919-11735941 TGCTTCGGCACCAGATTGCCTGG + Intronic
1145066019 17:19761960-19761982 CTCCTCGGCCTCAGTGAGCCCGG + Intergenic
1145255854 17:21321989-21322011 GGCCTGGGCGTTAGTGTGCCTGG + Intergenic
1145320767 17:21765957-21765979 GGCCTGGGCGTTAGTGTGCCTGG - Intergenic
1146493050 17:33295932-33295954 TGCCTCAGCCTCAGAGTGCTGGG + Intronic
1148521271 17:48277871-48277893 GGCTTGGGCATCACTGTGCCTGG + Intronic
1152075311 17:78155873-78155895 TGCCTCGGCCTCACAGTGCTGGG + Intronic
1152295479 17:79464748-79464770 GGCCCTGGCCTCAGTGTGCCTGG - Intronic
1158938258 18:62384586-62384608 TTCCTCCGCCTCAGTGGGCCTGG + Intronic
1160216063 18:76932717-76932739 TGTCTCTCCATCAATGTGCCAGG - Intronic
1161217931 19:3104068-3104090 TGCCTCGGCCTCAAAGTGCTGGG + Intronic
1162926849 19:13934764-13934786 TGCCTGTGCATAAGTGTGCATGG + Intronic
1163343376 19:16724444-16724466 TACCTTGGCATCCGTGAGCCTGG - Exonic
1163501496 19:17679149-17679171 TGCCTCGGCCTCAAAGTGCTGGG - Intronic
1167526699 19:49988761-49988783 AGCCTCAGCACCCGTGTGCCAGG + Intronic
1167682752 19:50934890-50934912 TGCCTTGGCATCCCTGTGCTGGG - Intergenic
925077391 2:1028708-1028730 TGCCTCTGCATCTGTTTTCCAGG + Intronic
925793589 2:7518966-7518988 TGCCTCAGCATCAGTTGTCCTGG - Intergenic
929870194 2:45752764-45752786 TACCTCCACCTCAGTGTGCCTGG + Intronic
931669000 2:64630174-64630196 TACCCCTGCATCAGTGTGCTAGG + Intergenic
932291456 2:70583529-70583551 TGCCACGTCCTCACTGTGCCTGG - Intergenic
932406125 2:71513559-71513581 TCCCTCCCCATCAGTGAGCCAGG - Intronic
935622096 2:105139170-105139192 TGCCACAGAATAAGTGTGCCTGG + Intergenic
941194099 2:162424890-162424912 TGACTGGGCCACAGTGTGCCTGG + Intronic
941209199 2:162615184-162615206 TTTCTAGGCATCAGTGTGCAGGG + Intronic
941682899 2:168418111-168418133 TGCCTCGGCCTCAAAGTGCTGGG - Intergenic
942525667 2:176850206-176850228 TGTCTAGGCATCAGCTTGCCAGG + Intergenic
946321292 2:218955925-218955947 AGCCTGGGCATCTGAGTGCCTGG - Intergenic
946329878 2:219002989-219003011 TGCGTCGGCAGCAGCGTGTCCGG + Exonic
947542505 2:230988614-230988636 TTCCATGGCTTCAGTGTGCCAGG + Intergenic
948017846 2:234704473-234704495 TGCCTCGGCCTCAAAGTGCTGGG + Intergenic
1170033816 20:11969609-11969631 TGTCAGGGCCTCAGTGTGCCTGG + Intergenic
1172592866 20:36129556-36129578 TGCTTCGGGAGCAGTGAGCCTGG - Intronic
1176383480 21:6125626-6125648 TGGCTGGGCATAAGTGTGGCCGG + Intergenic
1178024649 21:28452423-28452445 TCCCTCTGCTTCAGTGTGGCAGG + Intergenic
1179716463 21:43291182-43291204 TGGCTCAGCCTCACTGTGCCAGG + Intergenic
1179739988 21:43412612-43412634 TGGCTGGGCATAAGTGTGGCCGG - Intergenic
1182333786 22:29569738-29569760 TGCCTCGGCCTCCGAGTGCTGGG - Intronic
1183302360 22:37064544-37064566 AGCCTTGGCACCAGTGTGCAGGG - Intergenic
1185280942 22:49969601-49969623 TGCCAAGGCTACAGTGTGCCAGG + Intergenic
954035041 3:47846888-47846910 TGCCCCGTCATCAAGGTGCCTGG + Exonic
954676668 3:52319648-52319670 TGCCTGGGAATGAGTGTGACTGG - Intronic
954681508 3:52348621-52348643 TGCCTGGGCATGACTCTGCCTGG - Intronic
957086887 3:75688312-75688334 TTCTTCAGCAGCAGTGTGCCTGG - Intergenic
957380070 3:79416353-79416375 TGCCTCAGCCTCAAAGTGCCAGG - Intronic
961640562 3:128362187-128362209 CCCCTCTGCCTCAGTGTGCCAGG + Intronic
962733120 3:138300909-138300931 TGCCTCGGCATCAGTGTGCCTGG + Intronic
966817912 3:183904461-183904483 AGCCTCGGCAGCAGTGTCCTGGG - Intergenic
969080188 4:4611930-4611952 TGTCCAGGCATCTGTGTGCCTGG - Intergenic
969276879 4:6141743-6141765 ATCCTCGGCATCAGTGTCCTGGG - Intronic
971886659 4:32458211-32458233 TGTGTTGGCATGAGTGTGCCTGG - Intergenic
973978876 4:56289643-56289665 TGCCTGGGCAACAGAATGCCTGG + Intronic
981832415 4:149017576-149017598 TGCCTGGGCATCACTGGGCAAGG + Intergenic
984507721 4:180640236-180640258 TGCCTGGGCATCAGTCTTCAGGG - Intergenic
984639032 4:182143468-182143490 TGCCTCGGAATCCGTCTTCCCGG + Intergenic
985664341 5:1174090-1174112 AGTCTCGGCATCAGTCTGCTGGG - Intergenic
986395165 5:7322015-7322037 TGCCTCTGCAGCAGGGTGACCGG - Intergenic
991020086 5:61971480-61971502 TGCTTCAGTACCAGTGTGCCAGG - Intergenic
992273461 5:75089985-75090007 TGCCTGTGCTGCAGTGTGCCTGG - Intronic
992528112 5:77630706-77630728 GGCGTGGGCAGCAGTGTGCCGGG + Exonic
993437090 5:87911083-87911105 AACCTTGGCATAAGTGTGCCTGG + Intergenic
995749453 5:115438866-115438888 TGCCTCGGCCTCAAAGTGCTGGG - Intergenic
996075631 5:119189796-119189818 TTCCTCGGCACCAGTAAGCCAGG + Exonic
997601163 5:135139580-135139602 TGCCTCGGCATCTGAGGTCCTGG - Intronic
999679627 5:154044571-154044593 TGGCTCAAAATCAGTGTGCCAGG + Intronic
1000170261 5:158695455-158695477 TGCCTCCTCATCAATGAGCCAGG + Intergenic
1004665119 6:17742149-17742171 TGCCTCGGCCTCAAAGTGCTGGG - Intergenic
1006365122 6:33610787-33610809 TGCCTCGGCATTCTGGTGCCTGG + Intergenic
1007197496 6:40075374-40075396 TCCCTAGGCCTCAGGGTGCCTGG + Intergenic
1008833227 6:55794709-55794731 TCCCTGGTCATCAGTGTTCCCGG + Intronic
1010206354 6:73325849-73325871 TGGCTGGGGTTCAGTGTGCCAGG + Intergenic
1011055016 6:83194427-83194449 TGCCTCGCAATCAGCCTGCCTGG - Exonic
1016745624 6:147576387-147576409 TGCCTCGGCCTCAAAGTGCTAGG + Intronic
1019317128 7:391924-391946 GGCCTCGCCACCTGTGTGCCTGG + Intergenic
1022283164 7:28930793-28930815 TTCCTCTGCATCAGTGGCCCTGG + Intergenic
1029733207 7:102451224-102451246 GGCCTCTGCCTCAGTTTGCCCGG + Exonic
1029931984 7:104382109-104382131 TCCCTCTGCATCCATGTGCCTGG - Intronic
1034121873 7:148635462-148635484 TGCCCCGGCACCAGAATGCCTGG + Intergenic
1034168343 7:149043037-149043059 AGCCTGGGCAACATTGTGCCTGG - Intergenic
1034575284 7:151991339-151991361 TGCCTCAGCCTCATAGTGCCGGG + Intronic
1034976968 7:155454499-155454521 TGGCTCGGCATCCGGGCGCCCGG + Intergenic
1035071326 7:156147250-156147272 GGCCTCTGCCTCACTGTGCCTGG - Intergenic
1036383699 8:8259486-8259508 TGCCTCAGCATCTGTGTGCCTGG + Intergenic
1037798460 8:22016753-22016775 TGCCTCGGCCTCAACGTGCTGGG - Intergenic
1044693758 8:94902950-94902972 TGCCTCGGCCTCAAAGTGCTGGG + Intronic
1047676540 8:127208892-127208914 AGCCTTGGCATCACTCTGCCAGG - Intergenic
1048978667 8:139690940-139690962 TGCCTTTTCATCAGTGTGCCAGG - Intronic
1049375749 8:142288251-142288273 AGGCTCGGCCTCAGTGTTCCAGG + Intronic
1050282626 9:4066909-4066931 TGCCTGGGTGTCAGTGAGCCGGG - Intronic
1050472473 9:6007774-6007796 TGCCGGGGCATGAGTGTGCCCGG - Exonic
1053438479 9:38094282-38094304 TGCCTCGGCCTCAAAGTGCTGGG + Intergenic
1053750347 9:41247450-41247472 TTCTTCAGCAGCAGTGTGCCTGG - Intergenic
1054255850 9:62811788-62811810 TTCTTCAGCAGCAGTGTGCCTGG - Intergenic
1054335459 9:63803820-63803842 TTCTTCAGCAGCAGTGTGCCTGG + Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1059188071 9:112295123-112295145 TGCCTCGGCCTCTGAGTACCTGG - Intronic
1060876602 9:127088352-127088374 ACCCTTGGCATCTGTGTGCCTGG - Exonic
1061113654 9:128593920-128593942 GGCCTGGGGATAAGTGTGCCTGG + Intronic
1061214329 9:129212313-129212335 TGCCTCAGCCACTGTGTGCCCGG + Intergenic
1061419016 9:130463331-130463353 CTCCTCGGCATCAGTGTGGACGG + Intronic
1062218712 9:135403057-135403079 TGCAGCGGCTTCTGTGTGCCAGG - Intergenic
1062581476 9:137230967-137230989 AGCCTCGGCCTCACTGTCCCTGG - Intronic
1187466781 X:19534636-19534658 AGCCTCGGGTTCAGTGTGCTTGG - Exonic
1198159217 X:133990212-133990234 AGCATTGGGATCAGTGTGCCTGG - Intergenic
1198270319 X:135051136-135051158 TGCCAGGGCTTAAGTGTGCCTGG - Exonic
1199047648 X:143195238-143195260 TCACACGGCATCAGAGTGCCAGG + Intergenic