ID: 962738053

View in Genome Browser
Species Human (GRCh38)
Location 3:138343462-138343484
Sequence CTCCAGCTTCATTAGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962738053_962738059 -7 Left 962738053 3:138343462-138343484 CCTAGCTCCTAATGAAGCTGGAG No data
Right 962738059 3:138343478-138343500 GCTGGAGGAGGTGGTAGGTGTGG No data
962738053_962738061 -3 Left 962738053 3:138343462-138343484 CCTAGCTCCTAATGAAGCTGGAG No data
Right 962738061 3:138343482-138343504 GAGGAGGTGGTAGGTGTGGAGGG No data
962738053_962738060 -4 Left 962738053 3:138343462-138343484 CCTAGCTCCTAATGAAGCTGGAG No data
Right 962738060 3:138343481-138343503 GGAGGAGGTGGTAGGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962738053 Original CRISPR CTCCAGCTTCATTAGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr