ID: 962739527

View in Genome Browser
Species Human (GRCh38)
Location 3:138352877-138352899
Sequence GAGAAGTCACAGATGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 295}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962739527_962739532 4 Left 962739527 3:138352877-138352899 CCAGGCTGCATCTGTGACTTCTC 0: 1
1: 0
2: 2
3: 35
4: 295
Right 962739532 3:138352904-138352926 CAGCCCTCAGTGTCGTCATGGGG 0: 1
1: 0
2: 4
3: 17
4: 129
962739527_962739531 3 Left 962739527 3:138352877-138352899 CCAGGCTGCATCTGTGACTTCTC 0: 1
1: 0
2: 2
3: 35
4: 295
Right 962739531 3:138352903-138352925 CCAGCCCTCAGTGTCGTCATGGG 0: 1
1: 0
2: 2
3: 18
4: 140
962739527_962739529 2 Left 962739527 3:138352877-138352899 CCAGGCTGCATCTGTGACTTCTC 0: 1
1: 0
2: 2
3: 35
4: 295
Right 962739529 3:138352902-138352924 CCCAGCCCTCAGTGTCGTCATGG 0: 1
1: 0
2: 2
3: 23
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962739527 Original CRISPR GAGAAGTCACAGATGCAGCC TGG (reversed) Intronic
900833805 1:4984844-4984866 CAGAACTCACAGATGCAGCTTGG - Intergenic
901815132 1:11789430-11789452 AACAAGTCACAGCTGCAGCTGGG - Exonic
902230535 1:15024619-15024641 GGGAAGGCACAGCAGCAGCCAGG + Intronic
902513123 1:16976783-16976805 GAGGAGTCACCTCTGCAGCCAGG + Exonic
902721783 1:18308918-18308940 GGGCACTCACAGGTGCAGCCTGG + Intronic
903062495 1:20679513-20679535 GAGAAGGCAGAGAGGCAGGCAGG + Intronic
903232414 1:21929984-21930006 GAGAAGTCACTGAAGGGGCCCGG - Intronic
903706810 1:25291953-25291975 GAGAACCCACAGTTCCAGCCTGG + Intronic
903720423 1:25401388-25401410 GAGAACCCACAGTTCCAGCCTGG - Intronic
904213387 1:28900581-28900603 GAGAAGTAAATGATCCAGCCAGG - Intronic
904858556 1:33518112-33518134 GAAGAGTCACAGAGCCAGCCAGG - Intronic
905357492 1:37394944-37394966 GAGAAAGCACAGAAGCAGCAAGG + Intergenic
906085433 1:43129284-43129306 GAGAGGTTTCTGATGCAGCCAGG + Intergenic
906941681 1:50261142-50261164 TAGAAGTCAGTGAAGCAGCCTGG - Intergenic
910013227 1:82490995-82491017 GAGGAGACTCAGATGCTGCCAGG + Intergenic
912040114 1:105379181-105379203 AAGAAATCACAGATGAGGCCGGG - Intergenic
914256051 1:145961773-145961795 GCGAGGGCACAGATGGAGCCGGG + Exonic
915631018 1:157154368-157154390 GAGTAGTCACAGCTGCTGCGAGG + Intergenic
916690425 1:167185038-167185060 GAGACTTCTCAGGTGCAGCCTGG - Intergenic
917908127 1:179609968-179609990 AAGAAGTAACAGAAACAGCCTGG - Intronic
919854043 1:201693727-201693749 GAGGAAGCAAAGATGCAGCCAGG + Intronic
919902365 1:202053650-202053672 AAAAAATAACAGATGCAGCCAGG + Intergenic
921923239 1:220690808-220690830 GAGGGGTCGCAGGTGCAGCCCGG - Intronic
922419597 1:225450573-225450595 CAGAAGAAACAGTTGCAGCCGGG - Intergenic
923087314 1:230711478-230711500 GAGAACTTACAGCTGCAGGCAGG - Intronic
923125095 1:231027781-231027803 GAGCATTCACAGATGCAGTGGGG - Intronic
923396333 1:233568735-233568757 TAAAAGACAAAGATGCAGCCAGG - Intergenic
1062790954 10:306249-306271 GACCTGTCACAGATGCAGGCAGG + Intronic
1062917538 10:1253254-1253276 GGGAAGTCACAGAAACATCCTGG - Intronic
1063056417 10:2509668-2509690 GAGAAGAAACAGGTACAGCCAGG - Intergenic
1063164202 10:3445042-3445064 GAGAAGACCCAGAAGCAACCTGG - Intergenic
1063239041 10:4149456-4149478 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239045 10:4149482-4149504 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239049 10:4149508-4149530 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239053 10:4149534-4149556 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063239057 10:4149560-4149582 AAGAAGACACAGAGGCAGCTGGG - Intergenic
1063438193 10:6051267-6051289 GAGATGTCACGCATGCAGCCGGG + Intronic
1064289721 10:14022703-14022725 GATAAGTCAAAGATGCACACTGG + Intronic
1064799131 10:19049080-19049102 GTGAAGTCACAAATGCTGTCAGG - Exonic
1065638846 10:27759909-27759931 GAGCAGCCACAGATGCCACCGGG + Intergenic
1066010468 10:31189685-31189707 CAGAAATCAGAGATGCAGCTAGG + Intergenic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1067582299 10:47453277-47453299 GAGAAGCCAGAGAAACAGCCAGG + Intergenic
1067666644 10:48284978-48285000 GAGAAGGCATGGCTGCAGCCTGG - Intergenic
1067790599 10:49284569-49284591 GGGGAGTCTGAGATGCAGCCAGG - Intergenic
1070253049 10:74789973-74789995 CAGAAATCATAGAGGCAGCCAGG + Intergenic
1071134476 10:82437876-82437898 GAGACGTCACTGAAGGAGCCTGG + Intronic
1071241481 10:83710707-83710729 GTGATGTCACAGATGCAGGTGGG + Intergenic
1071763722 10:88637858-88637880 GAGATGTCACTGAAGGAGCCTGG + Intergenic
1073232794 10:101986685-101986707 GAGAAGTGAGAGCAGCAGCCTGG + Intronic
1073951481 10:108814236-108814258 CAGAAGTCAAAAATGCAGCAGGG - Intergenic
1074794406 10:116926968-116926990 AGGAAGTCACATATGCAGACAGG - Intronic
1075159681 10:120012191-120012213 GAGCAGTGACAGATGCTGCCAGG - Intergenic
1075320869 10:121490932-121490954 GAGAGCTCACAGAAGCTGCCTGG + Intronic
1075481870 10:122789108-122789130 GACAGGTCAGGGATGCAGCCTGG - Intergenic
1075626731 10:123969318-123969340 GAGGAGACACACATGCAGGCAGG - Intergenic
1075883152 10:125872200-125872222 GAGAAGACAAAGATGCAACTGGG - Intronic
1076078173 10:127554262-127554284 CAGAAGCCAGAGATGCAGACAGG + Intergenic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1077705704 11:4483039-4483061 GAGAAGTGACAGATCCAAACTGG - Intergenic
1078452425 11:11450125-11450147 GGGAAGTAAGAGATGGAGCCAGG + Intronic
1078648180 11:13162121-13162143 GAGAAGTAATAGAAGCAGCTGGG - Intergenic
1078655683 11:13236649-13236671 GAGGAGCCACAGAGGCAGCATGG + Intergenic
1080667662 11:34349968-34349990 GGGATGTGAGAGATGCAGCCAGG - Intronic
1082125625 11:48428414-48428436 GAGAAGTCACAGATGAAACTTGG - Intergenic
1082250798 11:49977796-49977818 GAGAAGTCACAGATGAAACTTGG + Intergenic
1082559240 11:54599444-54599466 GAGAAGTCACAGATGAAACTTGG - Intergenic
1083105385 11:60353189-60353211 GAGAAGTGACAGATTCAGTTGGG - Intronic
1084779023 11:71396712-71396734 GGGAAGCCACAGAGGCAGGCTGG + Intergenic
1084858651 11:72004378-72004400 GAGGAGTCACATCTGAAGCCAGG + Intronic
1084982936 11:72841635-72841657 GAGCAGTCAGAGAAGCAGCCAGG - Intronic
1086029265 11:82333940-82333962 GAGAAGTAATGGATTCAGCCAGG - Intergenic
1087021574 11:93608448-93608470 ATGAAGTCATAGATGCAGGCTGG + Intergenic
1088831285 11:113539102-113539124 GAGGGGGCACAGAAGCAGCCTGG + Intergenic
1088920521 11:114257276-114257298 GAGGAGGAACAGGTGCAGCCTGG + Intergenic
1093742891 12:22708347-22708369 GAGAAGTCACTGGTGCAGTGTGG + Intergenic
1093896449 12:24579975-24579997 GAGAAGTTTCAGATGGAGCATGG + Intergenic
1097223622 12:57464221-57464243 AAGAAGTCACAGATGGGGCCGGG + Intronic
1098389091 12:69950292-69950314 GAGAGGTCACAGAAGTAGGCAGG + Intronic
1100494781 12:95114307-95114329 TAGAAGTCAGAGATGCAGACTGG + Intronic
1101370522 12:104125322-104125344 GAGAAGTTACAGCTTCAGGCCGG + Intronic
1102163198 12:110785984-110786006 GAGAAGTCACAAATTCAGCATGG - Intergenic
1107553686 13:41499353-41499375 GAGAAGGCACAGAACCAGCTTGG - Intergenic
1108200716 13:48039960-48039982 GAGAAGTCACAGGTCTAGTCTGG + Intronic
1108707272 13:53000959-53000981 GAGCAGGCACAGAGGCATCCAGG + Intergenic
1110827694 13:79991689-79991711 GAGAAGTCACAGATGGCCCCAGG - Intergenic
1112199566 13:97261801-97261823 GGGAAGTGAGGGATGCAGCCTGG - Intronic
1114320968 14:21546903-21546925 GAAAAGTCACAGACACAGGCCGG - Intergenic
1115447286 14:33505831-33505853 GTGAAGTCAGAGAAGCAGCCTGG - Intronic
1117848441 14:59939302-59939324 GAGAAGTAACAGATGAAGACAGG + Intronic
1119261544 14:73240859-73240881 TAGAAGCCACAGAGGCAGCTGGG + Intronic
1119485047 14:74981532-74981554 GAGCAGGCGCAGAGGCAGCCAGG - Intergenic
1119643514 14:76331321-76331343 GTGAATTCACAGATGGGGCCAGG - Intronic
1119786979 14:77321157-77321179 GCGAAGTGCCAGATGCAGGCGGG + Exonic
1121310102 14:92931322-92931344 GTGAAGCCACAGACGGAGCCAGG + Exonic
1122972048 14:105156289-105156311 GAGAAGGCACGGCTGCTGCCAGG + Intronic
1123874666 15:24611750-24611772 GACAAACCACAGATGCAGACTGG + Intergenic
1124866529 15:33497421-33497443 GAGAAGTTAGAGATGAAGCCTGG - Intronic
1124913577 15:33946826-33946848 GAGAAGTCACAGATGTAGTGCGG + Intronic
1125479319 15:40069575-40069597 GAGCAGCCTCAGAGGCAGCCTGG - Intergenic
1127829166 15:62735183-62735205 GAAATTTCACAGATGAAGCCTGG - Intronic
1127904015 15:63362849-63362871 GAGAAGAGACAGAAGTAGCCAGG - Intronic
1128222506 15:65979234-65979256 AGGAGGTCACAGATGCAGCCTGG + Intronic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128632364 15:69279844-69279866 TAAAAGTCACCGATGCAGGCGGG + Intergenic
1129331615 15:74830707-74830729 CAGAAGCCACAGATACATCCCGG + Exonic
1129475979 15:75784954-75784976 GAGAAGGCACAGAGGTTGCCAGG - Intergenic
1130111128 15:80966614-80966636 GAGTGGACACAGAGGCAGCCTGG - Intronic
1131188305 15:90293787-90293809 GAGAAGGCACAGAGGTTGCCAGG - Intronic
1131380205 15:91957266-91957288 TAGAAGTCAAGGAGGCAGCCAGG - Intronic
1133859097 16:9577098-9577120 GAGAACACACAGATGCAGAGAGG - Intergenic
1133980831 16:10632106-10632128 GAGAAGTGACAGAAGCAGCCTGG + Intronic
1135877066 16:26212583-26212605 AAGAAGTCACAGGTGAAGCCAGG + Intergenic
1136003051 16:27310776-27310798 GAGCAGTCACAGATAAAGTCTGG + Intergenic
1136172445 16:28497053-28497075 CAGAAGTCCCAGAGGCAGGCGGG + Exonic
1137754234 16:50888761-50888783 GAGAATAAACAGATCCAGCCTGG + Intergenic
1138515864 16:57535345-57535367 GAGGAGCCACAGAGACAGCCTGG + Intronic
1138635225 16:58332969-58332991 TAAAAAACACAGATGCAGCCGGG - Intronic
1139303977 16:65967744-65967766 GAGAGGTCAGAGAAGCAGCCAGG - Intergenic
1139969090 16:70762740-70762762 GAGAAGTGACAGGTGCTGCGAGG - Intronic
1140449557 16:75059513-75059535 GAGAAATCTCAGATGCAGTGGGG + Intronic
1140899590 16:79355485-79355507 GAGAAGTGAGAGAAGGAGCCTGG + Intergenic
1141501365 16:84446527-84446549 GGAACGTCACAGAAGCAGCCAGG - Intronic
1142577886 17:921470-921492 GACAAGCCACAGATGCAGAGGGG - Intronic
1142736559 17:1904115-1904137 GAGAAGCTGCAAATGCAGCCAGG - Intergenic
1142877518 17:2860960-2860982 GTGAGGTCACAGAAGCAGGCAGG - Intronic
1142946992 17:3438051-3438073 GAGAAGTCACAGAAGCAAGCAGG + Intergenic
1143252705 17:5534924-5534946 GTTAAGACACAGATTCAGCCGGG + Intronic
1144409605 17:14987881-14987903 AAGAAGTCACATCTTCAGCCTGG - Intergenic
1144699161 17:17325504-17325526 GAGAAGAGACAGAAGCAGACAGG - Intronic
1146328519 17:31907514-31907536 GAGAAGTGATAGACGCAGACTGG + Intergenic
1146607530 17:34273847-34273869 CAGAGGTCACAGATCAAGCCTGG - Intergenic
1147559951 17:41502612-41502634 AAGAAGTTACAGAGGGAGCCAGG + Intronic
1148001916 17:44393564-44393586 GACAAGTCAAAGAGGCAGACTGG - Intergenic
1148152720 17:45405707-45405729 GAGGAGTTGGAGATGCAGCCGGG - Exonic
1148419386 17:47532121-47532143 GAGAAGTCAGCGAGGCTGCCTGG - Intronic
1149082277 17:52673514-52673536 GAGAACTCACATATGCACCTTGG + Intergenic
1149380318 17:56087125-56087147 GAGATGGCACTGATGGAGCCAGG + Intergenic
1152181365 17:78823690-78823712 GAGAAGGCAAAGAGGCAGGCAGG + Intronic
1154291805 18:13115287-13115309 GAGAAGTGACAGAGGCAGCTTGG + Intronic
1155275956 18:24187761-24187783 GAGAAGCTACAGAAGCAGCATGG + Intronic
1155791119 18:29971837-29971859 AAGAAGACACAGAGGCAGGCTGG - Intergenic
1157110341 18:44814681-44814703 GAGAAGAGATAGATGCAGGCTGG + Intronic
1157562446 18:48658055-48658077 GAGAAGTCAGAGAAGCAGGAAGG - Intronic
1157750461 18:50173669-50173691 GGGAAATCACAGATGATGCCTGG + Intronic
1157818714 18:50750037-50750059 GAGGAGTGACAGTGGCAGCCTGG - Intergenic
1158668880 18:59456818-59456840 GAGCAGGCCCAGAGGCAGCCTGG + Intronic
1158745004 18:60189534-60189556 TAGAAGTCACAAATGCAGCATGG - Intergenic
1160328000 18:77968263-77968285 GAGATGGCAGGGATGCAGCCAGG + Intergenic
1160904175 19:1444857-1444879 GAGACGGCACAGATGGGGCCGGG - Intergenic
1162114703 19:8421868-8421890 GAGCAGTCACACAGGGAGCCGGG - Exonic
1162641616 19:12014639-12014661 GAGAAGTCACAGAGGGAGAATGG - Intergenic
1162838009 19:13334186-13334208 AAGAAGTCTAAGATGAAGCCAGG - Intronic
1163261698 19:16194569-16194591 GGGAAGTCACAGCTGTGGCCGGG - Intergenic
1164581230 19:29436486-29436508 AGGAAATCACAGATGCATCCTGG + Intergenic
1165420228 19:35718563-35718585 GAGAAGCCCCGGCTGCAGCCAGG + Intronic
1166881293 19:45931710-45931732 GAGGTGTCAGAGATGCAGCTTGG - Intergenic
1168344770 19:55644776-55644798 GAGGAGTCACAGAGGGAGCCAGG + Exonic
1168701687 19:58443661-58443683 GAAAAGTCACAGATCCTGACAGG - Intergenic
927713492 2:25339851-25339873 CAGATGTGACAGCTGCAGCCAGG - Intronic
929488303 2:42374310-42374332 GAGAAGTCAGAGGTGGAGTCTGG - Intronic
933815695 2:86066648-86066670 GGGAACTCACAAATGCAGTCTGG + Intronic
936097025 2:109538208-109538230 GAGATGTGACAGCTGAAGCCAGG - Intergenic
937114567 2:119395738-119395760 CAGAAGTCACGGATGCAGTCTGG + Intergenic
937254437 2:120545193-120545215 GAAAAGTCACAGACGTGGCCGGG + Intergenic
938439014 2:131309019-131309041 TAGAAGTCACAGATGATGGCAGG - Intronic
938641575 2:133286289-133286311 AAGAAGTCACAGAAGAGGCCGGG - Intronic
938841411 2:135168541-135168563 GTGGAGTCATAGCTGCAGCCTGG - Exonic
939994250 2:148905683-148905705 GAGAAGGGAGAGATGGAGCCAGG + Intronic
940853239 2:158707784-158707806 TAGAAGTCACAGATTCAGGATGG - Intergenic
941807994 2:169728651-169728673 GAGAATTCAGATATGCAGCCAGG - Intronic
943731775 2:191309595-191309617 GAGAAGTAACAAATGCAGTCAGG - Intronic
944846276 2:203671420-203671442 GAGAAGTCCTAGAAGAAGCCTGG - Intergenic
947324625 2:228961031-228961053 GAGAAGCCACATTTGCAGCGTGG + Intronic
948259805 2:236595233-236595255 GAGAAAAAACAGATGCAGCACGG + Intergenic
948770597 2:240249667-240249689 GAGAAGACACAGACGGAGGCAGG - Intergenic
948821730 2:240553258-240553280 GAGAAGACAGAGAGGGAGCCTGG - Intronic
1168994901 20:2125801-2125823 CAGGAGCCACATATGCAGCCAGG + Intronic
1170921000 20:20679281-20679303 GAGAAGTCAAAGATGCTTTCAGG - Intronic
1173564671 20:44030178-44030200 GAGAAGAGACACATCCAGCCAGG - Intronic
1173565551 20:44035859-44035881 GAGAAGTAAAGGAAGCAGCCTGG + Intronic
1174023005 20:47546825-47546847 GAGATGTAACAGAGGCAGGCCGG - Intronic
1174520465 20:51126176-51126198 GAGATGGCACGCATGCAGCCAGG - Intergenic
1175078958 20:56402009-56402031 AAGAAGTTACAAATGAAGCCAGG + Intronic
1175353447 20:58343182-58343204 GAGAAGTAACAGCTGCACCAAGG - Intronic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1176887517 21:14274037-14274059 GGGAAGTGACAGCCGCAGCCGGG + Intergenic
1179417470 21:41209780-41209802 GAGAAGACACAGGTGTATCCTGG + Intronic
1180047716 21:45317477-45317499 GTGAGGTCCCAGAAGCAGCCTGG - Intergenic
1180867601 22:19128352-19128374 AAGAAGGCAGATATGCAGCCAGG + Intergenic
1181010446 22:20037228-20037250 GAGAAGTCAAAGTGGCGGCCAGG + Intronic
1181530287 22:23513450-23513472 GAGAAGTCACAGACTCAGACAGG + Intergenic
1182294542 22:29305373-29305395 GAGAAGACAGGGATGGAGCCGGG - Intergenic
1182485716 22:30637324-30637346 GAGATCTCACCAATGCAGCCTGG - Intronic
1183104898 22:35608711-35608733 GTGAAGTCACACATGGAGTCGGG - Intronic
1183474200 22:38026881-38026903 GAGGAGCCTCAGAGGCAGCCGGG - Intronic
1183893171 22:40947746-40947768 GAGATGTCAGAGAGGCAGGCAGG - Intergenic
1184206455 22:43007042-43007064 GAGAAGTCAGGGATGCAGATGGG - Intronic
1185261652 22:49868813-49868835 GAAACGTCACGGATGCAGGCCGG + Intronic
950045094 3:9944337-9944359 GAGGAGCAAGAGATGCAGCCTGG - Intronic
951782520 3:26380130-26380152 TAGAGGTCACAAATGCAGGCAGG + Intergenic
953115554 3:39989357-39989379 GAGATGTCACACAAGGAGCCTGG + Intronic
953360377 3:42290581-42290603 GAGAAAGGACAGATGCAGGCAGG - Intergenic
953447524 3:42980467-42980489 GAGCAGGCACGGAAGCAGCCAGG - Intronic
954871610 3:53771519-53771541 GGGAAGTCACAGATCCTGCTGGG + Intronic
958486627 3:94719935-94719957 GAGAGGTTACAGGTGCAGACTGG - Intergenic
958903944 3:99921496-99921518 GGGAAGTCACATATGCATCAAGG + Intronic
958960299 3:100503408-100503430 AAGAAGTCATAGAAGCAGCAAGG - Intronic
961385499 3:126521316-126521338 GTGAAGTCAGAGAGGCAGACAGG - Intergenic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962739527 3:138352877-138352899 GAGAAGTCACAGATGCAGCCTGG - Intronic
962918217 3:139927802-139927824 GAGAGGTCAGAGAAGCAGGCAGG + Intergenic
962927816 3:140011556-140011578 GAGAATACACAGATGCTACCTGG + Intronic
965396495 3:168165652-168165674 CAGCAGTTACAGAGGCAGCCTGG + Intergenic
966465632 3:180228267-180228289 AAGGAGCCACAGATGCTGCCTGG + Intergenic
966983504 3:185159132-185159154 GAGAAGGCACTGAGGCAGGCAGG - Intergenic
967115112 3:186330437-186330459 GGCAAGTTACAGGTGCAGCCCGG - Intronic
968079117 3:195834444-195834466 AAAAAGTCCCAGATTCAGCCGGG - Intergenic
968637791 4:1690982-1691004 GATAATTCAGAGATGGAGCCAGG - Intergenic
969497627 4:7535085-7535107 GCAAAGTCACAGGTGCAGACAGG + Intronic
969530056 4:7725564-7725586 TAGAAGTCACAGAGGCAGGTAGG + Intronic
969676391 4:8616647-8616669 GAGAAGGCTCAGATGCTGTCTGG + Intronic
969892175 4:10270024-10270046 GAGATGTGACAGCTGCAGACAGG + Intergenic
974007819 4:56576563-56576585 GTAAAGTCACAGTTCCAGCCTGG - Intronic
978981104 4:114946571-114946593 GAGACAGCACAGATGAAGCCTGG + Intronic
979096347 4:116555629-116555651 GAAAAGTCACTGGAGCAGCCAGG - Intergenic
979440015 4:120740534-120740556 GAGGAGTCACAGATGAATCTAGG - Intronic
980535081 4:134109428-134109450 GAGAAATGACAGATGAATCCAGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985781558 5:1874333-1874355 CAGAAGGCAGAGAAGCAGCCAGG - Intergenic
986499654 5:8385554-8385576 GATGAGTCTAAGATGCAGCCAGG - Intergenic
987442958 5:17979811-17979833 TAGAAATCACAGATGTAGTCAGG - Intergenic
992553330 5:77880153-77880175 GAGGATTCACTGATGCAGCCAGG + Intergenic
993173056 5:84445368-84445390 GAGAAGTGTCATATGCAACCTGG - Intergenic
993419526 5:87683683-87683705 GAGTAGTCAAAGCTGCAGGCTGG - Intergenic
994450010 5:99929736-99929758 GAAAAGTCAGAGCTGCACCCAGG - Intergenic
995629116 5:114113886-114113908 GAGATTTCACAGAAGCTGCCAGG - Intergenic
996489264 5:124073474-124073496 TAAAACACACAGATGCAGCCTGG - Intergenic
997100758 5:130966339-130966361 GAGAAATTAAAGATGCAGCTGGG + Intergenic
997639935 5:135442501-135442523 GAGAAGACCCAGGTACAGCCTGG - Intergenic
997705415 5:135946880-135946902 GAGGTGTCAAAAATGCAGCCTGG + Intronic
998160319 5:139809396-139809418 GAGGAGTCCCAGGAGCAGCCAGG + Exonic
999348388 5:150844483-150844505 TAGCAGCCACAGATGAAGCCTGG + Intergenic
999566126 5:152863919-152863941 GAAAAGTCACAGCTGAATCCAGG - Intergenic
999933188 5:156455974-156455996 GAGAAGTCTCAGAGGGAGCATGG + Intronic
1000292042 5:159879509-159879531 AATGAGTCACAGAGGCAGCCAGG - Intergenic
1001526928 5:172435843-172435865 GAGAAGGCACAAATGGGGCCGGG + Intronic
1001555282 5:172632765-172632787 GCGGAGTCACAGAAGCACCCAGG - Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1002261529 5:177996650-177996672 GAGAAGTCACAAGTGCATGCTGG + Intergenic
1002371702 5:178760062-178760084 GAGAAGTATCAGAGGCGGCCGGG - Intergenic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1005278014 6:24240740-24240762 GAGAAGTAACAGATAAAGCTGGG + Intronic
1006210365 6:32388454-32388476 GAGAAGTCTTACATGCAGCAAGG - Intergenic
1006350071 6:33514417-33514439 GGGAAGTGACAGATCCAGCATGG - Intergenic
1006612382 6:35302020-35302042 TAAAAGACACAGATCCAGCCAGG - Intronic
1006954574 6:37856288-37856310 GAGAAGAAACAGAACCAGCCAGG - Intronic
1007013468 6:38439720-38439742 TAAAAGTCACAGTTGCGGCCAGG - Intronic
1007726740 6:43921347-43921369 GAGAAGGCACAGAGGCGGGCAGG + Intergenic
1008051573 6:46905079-46905101 GAGAAGGCATTGCTGCAGCCAGG + Intronic
1008221412 6:48858249-48858271 GAGAAGTCACAGGGCCAGCTTGG + Intergenic
1011383802 6:86771913-86771935 GGCAAGGCACAGATGCAGGCTGG + Intergenic
1012309206 6:97700402-97700424 AAGAAATCCCACATGCAGCCGGG + Intergenic
1012646189 6:101684983-101685005 GAGAAGACACAGAAGCAGGAAGG - Intronic
1017662358 6:156687224-156687246 GAGCGGGCACAGACGCAGCCGGG + Intergenic
1017833805 6:158157816-158157838 GACAAGTAACAGATCCAACCGGG + Intronic
1018246710 6:161830881-161830903 GAGAAGAAAGAGGTGCAGCCTGG + Intronic
1018431852 6:163729104-163729126 GAAAAGTCCCCGATGCACCCAGG + Intergenic
1018718366 6:166553189-166553211 GGGAGGTCAAAGATGCAGCGAGG - Intronic
1019058088 6:169237092-169237114 GAGCAGCCACAGCTGGAGCCGGG - Intronic
1020035662 7:4961461-4961483 TAGAAGTGGCAGATGCAGCCGGG + Intergenic
1023958609 7:44908143-44908165 GAGAAGTCAGACAGGGAGCCAGG - Intergenic
1024185541 7:46944840-46944862 TAAAAGTCAAAGATTCAGCCAGG - Intergenic
1024518795 7:50284646-50284668 GACAAGTGACAGATGGAGGCTGG - Intergenic
1027410997 7:77917665-77917687 GAAAAGTACCAGGTGCAGCCTGG - Intronic
1028922891 7:96326475-96326497 AAGAAGTCAAAGATGCTCCCTGG + Intergenic
1030116629 7:106066401-106066423 TGGAAGTCACAGCTGCACCCTGG + Intergenic
1030769665 7:113458261-113458283 GAGAAATCATAGGTACAGCCTGG + Intergenic
1033598469 7:142872498-142872520 GAGAAGTCAGAGATGAGGCTGGG + Intronic
1034658817 7:152751351-152751373 GAGCAGGCACAGATGCAGGGAGG - Intergenic
1034737320 7:153441052-153441074 GCGAAGTCAAGGATGCAGACAGG + Intergenic
1035766894 8:2113553-2113575 GAGAGGTGACAGTTGCAGCCAGG + Intronic
1036913131 8:12775770-12775792 GGGAACTTAGAGATGCAGCCTGG + Intergenic
1037367452 8:18138096-18138118 GAGAGCTCACAGATGCAGAGAGG + Intergenic
1037502154 8:19496677-19496699 GAGGAGTCACAGGTGCTGGCAGG + Intronic
1038392562 8:27217428-27217450 GAGAAGTTACTGATGCCCCCTGG - Intergenic
1038575078 8:28698199-28698221 GAGAAGTCAAAGATGATGCCAGG + Intronic
1039045124 8:33442577-33442599 AAGAAGTGACAGATGAGGCCAGG - Intronic
1039402323 8:37280045-37280067 GAGATGTCACTGAAGAAGCCTGG - Intergenic
1041985431 8:63917129-63917151 GAGAAGTCACTGAGGCAGGAAGG - Intergenic
1042550621 8:69991217-69991239 GAGAAGTCATGGATGAAGCAAGG + Intergenic
1043795701 8:84535766-84535788 TAGAAGTCAGGGATGCGGCCGGG - Intronic
1043875794 8:85484603-85484625 CAGCAGACACAGATGGAGCCAGG - Intergenic
1044133786 8:88559313-88559335 GTGAAATCATAGATGCAGGCTGG - Intergenic
1044903821 8:96978043-96978065 GAGGAGTCACAGATGCCCCATGG - Intronic
1045858816 8:106793183-106793205 GACCAGTCAGAGATGCCGCCTGG + Intergenic
1045866186 8:106868253-106868275 GTGAAGTCACAGATTCCCCCAGG + Intergenic
1046262649 8:111789708-111789730 GAGAAGTCAAAGATGAATGCAGG + Intergenic
1048226370 8:132590252-132590274 GAGAAGTTGCTGATGCAGACAGG - Intronic
1048911993 8:139144091-139144113 TAGAGGTCACATATGCAGCATGG - Intergenic
1048958594 8:139557113-139557135 GAGAAGTCAGTGGGGCAGCCTGG + Intergenic
1049808144 8:144550653-144550675 GAGAAGTCAGGGCAGCAGCCAGG + Intronic
1050376194 9:4975897-4975919 CAGTAATCACAGCTGCAGCCAGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053115814 9:35501278-35501300 CAGAAGTCACTGATACAGGCCGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055353712 9:75416185-75416207 GAGAAGTAAGAGAACCAGCCTGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056937921 9:90931859-90931881 GTGAAGTCACAGAAGCTGCCTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058580721 9:106453617-106453639 AAGAACTCACATATGCTGCCAGG - Intergenic
1058588137 9:106532352-106532374 GAGAAGGCACAGATGTGGCAAGG - Intergenic
1060316158 9:122512767-122512789 AAGAAGTCACAGATGGACACTGG - Intergenic
1060491465 9:124088293-124088315 CAGAAGGCACAGATGAGGCCAGG - Intergenic
1060521263 9:124295297-124295319 GACAAGCCACAGATGGAGTCTGG - Intronic
1061250070 9:129421358-129421380 GAGAAGTCGCAGAATCAGACGGG - Intergenic
1061888103 9:133603229-133603251 GAGAAACCACTGATGCACCCAGG + Intergenic
1062320150 9:135986747-135986769 CAGGGGTCAGAGATGCAGCCGGG - Intergenic
1062523238 9:136968267-136968289 AAGAGGTCACAGATGGGGCCCGG - Intergenic
1062631970 9:137467126-137467148 GAGAAGGCACAGATGCAGGTTGG - Intronic
1062722580 9:138052061-138052083 GAGAAGCCACAGATGCAGACAGG - Intronic
1185733987 X:2483597-2483619 GAGAAGACACAAATGCCCCCCGG + Intronic
1187283631 X:17882251-17882273 GAGAAGTTAAAGAAGCAACCAGG - Intergenic
1187333295 X:18360445-18360467 GAGAAGTCACTGCAGCGGCCAGG + Intergenic
1187757617 X:22545048-22545070 GAGAATTCTGACATGCAGCCTGG - Intergenic
1190017004 X:46836012-46836034 AAGAAAACACAGAAGCAGCCTGG + Intergenic
1190278877 X:48916857-48916879 AAAAAGTCATAAATGCAGCCGGG + Intronic
1192001876 X:67159699-67159721 GTGAAGTCACACAAGCACCCTGG - Intergenic
1192848711 X:74931213-74931235 GAGAAGCCCCAGATGAAGCCAGG + Intergenic
1197820783 X:130538889-130538911 GAGAAATCAGAGCTGCAGCGGGG + Intergenic
1199503689 X:148537687-148537709 GAAAAGTAACACATGCAGCCAGG - Intronic
1200767711 Y:7094373-7094395 GAGAAGCCAGTGATGGAGCCTGG - Intergenic