ID: 962739598

View in Genome Browser
Species Human (GRCh38)
Location 3:138353433-138353455
Sequence CTGTGTCTCTAGAAGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962739598_962739605 30 Left 962739598 3:138353433-138353455 CCTGGACCCTTCTAGAGACACAG 0: 1
1: 0
2: 1
3: 13
4: 172
Right 962739605 3:138353486-138353508 TTTGCGGATTCTCTCATTGTTGG 0: 1
1: 0
2: 1
3: 4
4: 98
962739598_962739603 14 Left 962739598 3:138353433-138353455 CCTGGACCCTTCTAGAGACACAG 0: 1
1: 0
2: 1
3: 13
4: 172
Right 962739603 3:138353470-138353492 GAGTCAGTCCACTGCATTTGCGG 0: 1
1: 0
2: 0
3: 12
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962739598 Original CRISPR CTGTGTCTCTAGAAGGGTCC AGG (reversed) Intronic
901491727 1:9600127-9600149 TTGTGTCTCTAGATGTGACCTGG - Intronic
901808869 1:11754584-11754606 CTGTGTCTCTAAACGGGCTCTGG + Intronic
901837989 1:11936457-11936479 CTGTATCACCAGAAGGATCCCGG + Intronic
906220507 1:44074527-44074549 CTGTGTGTCTAGAAGCTGCCAGG + Intergenic
907575834 1:55524866-55524888 CTCTGTGTCTAGAGGGGCCCTGG - Intergenic
908518932 1:64922043-64922065 CTGTGTCTCAGGAAGGGTGATGG - Intronic
912416276 1:109509958-109509980 CTGTGTAGCGAGAAGGGTGCTGG - Intergenic
917450433 1:175143472-175143494 ATGTGTCTCCAGAAGGGCTCTGG + Intronic
922855357 1:228770400-228770422 CTGTGTCAGTGGAAGGGTGCAGG + Intergenic
923485598 1:234427986-234428008 TTGTTTCTCTTGAAGAGTCCTGG - Intronic
1065325758 10:24549553-24549575 CTGTGCTTCTATCAGGGTCCAGG - Intergenic
1067429614 10:46234440-46234462 CTGTGGGTCTCGATGGGTCCTGG - Intergenic
1067741270 10:48897638-48897660 GTGTGTCTCTGGATGGCTCCTGG - Intronic
1067781145 10:49208464-49208486 CTGAGATTCTAGAGGGGTCCTGG + Intergenic
1068093206 10:52458366-52458388 TTGTGTTTTTAGAATGGTCCAGG - Intergenic
1069015817 10:63427707-63427729 TGGTGTCTCCAGAAGTGTCCAGG + Intronic
1071121466 10:82283678-82283700 CTGTGTATCTGGAAGGAGCCTGG + Intronic
1071290115 10:84182499-84182521 CTGTGAGTCTAGAATGGTCTCGG + Intronic
1073344946 10:102776003-102776025 CTCTGGCTCTAGGTGGGTCCAGG + Intronic
1074437075 10:113443393-113443415 CTGCCTCTCTAGGAGGATCCTGG - Intergenic
1074475967 10:113774876-113774898 CTGGGTCTCTGGAAGGGTCTGGG - Exonic
1075574713 10:123570135-123570157 CTGCGTTTCTAAAAGGCTCCTGG - Intergenic
1075840493 10:125498153-125498175 CTGAGTATTTAGAAGGATCCTGG + Intergenic
1075950557 10:126474051-126474073 CTGTGTGTCTAGCAAGTTCCTGG - Intronic
1076411552 10:130255092-130255114 CTGTGGCTGTTGAAGGGGCCTGG + Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1079561562 11:21827803-21827825 CCATGTCTCTAGAAAGGTGCAGG - Intergenic
1081917044 11:46738976-46738998 CTGTGTCTCGTGAAGGGGCGTGG + Intronic
1083846842 11:65340284-65340306 CTGCTTCTCTAGAAGGCTCAAGG - Intronic
1083892845 11:65605447-65605469 CTGTGCCTTTAGCAGGCTCCAGG - Intronic
1085526318 11:77166287-77166309 CTGTGGCTCCAGGAGGGGCCTGG + Intronic
1086869495 11:92019258-92019280 CTTTGTGTCAAGAAGGGACCTGG - Intergenic
1088733821 11:112708525-112708547 CTGTATCTCTAGAAGCCTCCTGG - Intergenic
1089570862 11:119408422-119408444 CTGTTTCTCTAGAAAGGCACAGG + Intergenic
1089859565 11:121576708-121576730 CGCTGTCTCTAGAAGGGTGGGGG - Intronic
1091131534 11:133150931-133150953 CTCTCTTTCTAGAAGGGTTCCGG - Intronic
1092887667 12:12939214-12939236 GTGTGCCTCTAGAAGGGTCCCGG - Intergenic
1096216764 12:49802065-49802087 GTGTGTGCCCAGAAGGGTCCTGG - Intronic
1096611425 12:52804521-52804543 CTCTGTTTCTAGAACAGTCCAGG - Intergenic
1096969948 12:55657646-55657668 CAGTGTCTCTACAGGGATCCTGG + Intergenic
1097727774 12:63094326-63094348 CTGTGTCTCTAGCCTGGTCAGGG + Intergenic
1098654582 12:73012093-73012115 CTGGGTCTCTAGAAAGGCCAGGG + Intergenic
1099944592 12:89229676-89229698 CTGTATCTCTATCTGGGTCCTGG + Intergenic
1100706456 12:97204957-97204979 CTAGGTCTCTAGCAAGGTCCAGG - Intergenic
1100909490 12:99342060-99342082 CTAGGTCTCTAGAAGAGTACTGG - Intronic
1103972910 12:124683189-124683211 CTGAGTGTCTAGAATGGTGCCGG + Intergenic
1105016092 12:132787554-132787576 CGGGGTCTCAGGAAGGGTCCTGG - Intronic
1112456179 13:99565853-99565875 CTGGGTCTCTAGAAATGACCTGG - Intergenic
1112537121 13:100270182-100270204 CTGTGTCTTTAGGAAGATCCTGG + Intronic
1116717779 14:48449351-48449373 CTGTTTCTCTGGAAGAGCCCTGG + Intergenic
1116888157 14:50240759-50240781 CTGAGTATTTAGAAGGATCCAGG + Intronic
1118539088 14:66802729-66802751 GGGTGTATCTAGAAGTGTCCAGG + Intronic
1119152333 14:72373023-72373045 CTGTGACTCTTGGAGGGTCAAGG + Intronic
1119527771 14:75335930-75335952 CTGTTTCTCTGAAAGGGGCCTGG - Intergenic
1121189765 14:92016322-92016344 CTGTGTCTCTCGCAGGAACCTGG + Intronic
1123632213 15:22269336-22269358 TTGTGTCACTGGAATGGTCCTGG + Intergenic
1123739139 15:23218307-23218329 CTGAGTTTCTAGTACGGTCCTGG + Intergenic
1124290357 15:28447263-28447285 CTGAGTTTCTAGTACGGTCCTGG + Intergenic
1124292880 15:28470285-28470307 CTGAGTTTCTAGTACGGTCCTGG - Intergenic
1125287048 15:38105043-38105065 CTGTGAATATTGAAGGGTCCTGG - Intergenic
1125534273 15:40434457-40434479 CTGTGTGTCTAGCACAGTCCTGG - Intronic
1126381409 15:48051159-48051181 CTGTGTCCCTATAAGGGCTCAGG + Intergenic
1127005368 15:54563176-54563198 ATTTGGCTTTAGAAGGGTCCCGG - Intronic
1127353513 15:58175635-58175657 CTGTGTCCCAAGAAGGCTGCTGG + Intronic
1127654627 15:61044762-61044784 CTGTATTTCTAGCAGGCTCCTGG - Intronic
1128820898 15:70652284-70652306 CTGTGTTTCTAGTAGTTTCCAGG - Intergenic
1131526008 15:93153169-93153191 CTGTGTCTCTTGGAGGACCCCGG + Intergenic
1132392641 15:101450273-101450295 CTGTGGCTGGAGAGGGGTCCTGG - Intronic
1132502943 16:292658-292680 CAGTGTCTCTTTGAGGGTCCTGG - Intronic
1132730188 16:1357207-1357229 CTGTGGATATAGAAAGGTCCTGG - Intronic
1133202220 16:4210899-4210921 CTGCGTCTCTAACAGGCTCCCGG - Intronic
1133503020 16:6383465-6383487 CTGTTTTTCTAGAAGGGGCTTGG - Intronic
1139429880 16:66905388-66905410 CAGTGCCTCTGGAAGGGGCCTGG + Intergenic
1139487073 16:67263954-67263976 CTGTGTAGCTAGAAGGGGGCAGG + Intronic
1140804563 16:78521024-78521046 GTGTGTTTCCAGAAGGGGCCTGG - Intronic
1141275634 16:82585405-82585427 GTGTGTGTCTACCAGGGTCCTGG + Intergenic
1143092846 17:4459215-4459237 CTGTGAGTTTAGCAGGGTCCAGG + Intronic
1145037419 17:19551137-19551159 CAGTGTCCCCAGAAGAGTCCTGG + Intronic
1146318299 17:31826374-31826396 CTGTGTCTCCAGAGTGGTCAAGG - Intergenic
1147428271 17:40356481-40356503 CTGGGTCTCAGGATGGGTCCTGG + Exonic
1150269529 17:63854467-63854489 CTGAGTCAATAGAAGGGTGCTGG - Intergenic
1152328691 17:79657915-79657937 CTGTGTCTCCAGGAGGGCCCAGG - Intergenic
1153943166 18:9994459-9994481 CTGTGTCTCGAGCATGGTCCCGG - Intergenic
1154172713 18:12062940-12062962 CTGTGTGTCCTGAAGGGCCCTGG + Intergenic
1154498374 18:14979169-14979191 CTCTGCCTCTAGAAGGCTCAGGG - Intergenic
1156641090 18:39099798-39099820 CTGTGTCTCTGGCAGGGGACAGG + Intergenic
1161457351 19:4376157-4376179 CTGTGTCTCAGGAAGGGCTCTGG - Intronic
1161731039 19:5960809-5960831 CCGTGTGTCCAGAAGGCTCCGGG - Intronic
1162463805 19:10829326-10829348 CTGTGTGTCCTGCAGGGTCCTGG + Intronic
1163084814 19:14971686-14971708 CTGAGGCTCTAGACGGGTCTTGG + Intronic
1163754569 19:19098983-19099005 CTCTGTCTCCAGCAGGGTGCAGG + Intronic
1166142985 19:40815358-40815380 CTGTGTCCCTGGCTGGGTCCTGG + Intronic
1168646665 19:58063385-58063407 CTGAGGCTCAGGAAGGGTCCTGG + Intronic
925662967 2:6222289-6222311 CTTTGTCTGTCTAAGGGTCCTGG + Intergenic
926560323 2:14409606-14409628 CTGTGTCTCTAGCAAGGCCAGGG - Intergenic
928248530 2:29653536-29653558 CTTTGTCTGTAAAAGGGTCATGG + Intronic
933815910 2:86068767-86068789 CTGTGGCTTCACAAGGGTCCCGG - Intronic
934163069 2:89270671-89270693 CTTTGGCACTAGTAGGGTCCTGG - Intergenic
934204204 2:89911853-89911875 CTTTGGCACTAGTAGGGTCCTGG + Intergenic
935444256 2:103139642-103139664 CTGTGTCTCTCCCAGGCTCCCGG + Intergenic
936460584 2:112711349-112711371 CTGTCCCTCTCCAAGGGTCCTGG + Intergenic
939103264 2:137920424-137920446 CTGTGTTTGTTGCAGGGTCCAGG - Intergenic
942640840 2:178059243-178059265 CTCTGTGTCTAGCAGGGTCCAGG + Intronic
942942614 2:181636981-181637003 TGGGGTCTCTAGAAGGTTCCAGG - Intronic
945386687 2:209209607-209209629 CCCTGTCTCTAGGAGAGTCCTGG + Intergenic
945740812 2:213658694-213658716 CTATGTCTCTAGAGAGGTGCTGG + Intronic
948542201 2:238699034-238699056 CTGTGCTTCCAGAAGGGCCCTGG - Intergenic
948744235 2:240074441-240074463 CTGTGTCTTTGGAAGGTTCTGGG + Intergenic
1175291268 20:57877090-57877112 CTTTGTCTCTGGTAGTGTCCTGG + Intergenic
1179990367 21:44945176-44945198 CTGTGCCTCTAGAAAGATCCAGG + Intronic
1181417509 22:22771315-22771337 CTGCTTCTCTAGAAATGTCCTGG - Intronic
1183354307 22:37350223-37350245 CAGTTTGTCTAGAAGGGGCCAGG + Intergenic
1184743454 22:46442503-46442525 CTGTGGCTCCTGAAGGCTCCTGG + Intronic
1184876088 22:47276546-47276568 GAGTGTCTCTGGAGGGGTCCTGG - Intergenic
1185252575 22:49812779-49812801 CCTTGTCTCCAGAATGGTCCTGG - Intronic
1185252586 22:49812841-49812863 CCTTGTCTCCAGAACGGTCCTGG - Intronic
1185252598 22:49812904-49812926 CCTTGTCTCCAGAATGGTCCTGG - Intronic
949996274 3:9619800-9619822 CTGGGGCCCCAGAAGGGTCCTGG - Intergenic
953947813 3:47164172-47164194 GTGTGTCTCTTTAAGGGGCCGGG - Intergenic
954446183 3:50548006-50548028 CTGTGTCTTCAGGAGGCTCCAGG + Intergenic
959167684 3:102800974-102800996 CTGTGTCTTAAGAAGCCTCCAGG - Intergenic
962290614 3:134133661-134133683 GTGTGTGTGTAGAAGGGTCGGGG + Intronic
962739598 3:138353433-138353455 CTGTGTCTCTAGAAGGGTCCAGG - Intronic
964309608 3:155378692-155378714 CTGTGTTTCTAGTAGTTTCCAGG - Intronic
966856758 3:184199459-184199481 ATGTGTCTCAAGGAGGCTCCAGG - Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967544177 3:190703923-190703945 CTGGGTCTCTAGAAGGTTAAGGG + Intergenic
968736742 4:2301224-2301246 CTGTGTCTCAAGCATGTTCCGGG - Intronic
969470455 4:7384643-7384665 CTGTCTCCCAAGAAGGGTCTTGG - Intronic
969886061 4:10216627-10216649 ATGTGCCTGTAGAAGGGTCAGGG - Intergenic
970939659 4:21616482-21616504 CTGTGTCTCTATTAGTGTCCTGG + Intronic
973834142 4:54792420-54792442 CTATGTCACCACAAGGGTCCTGG + Intergenic
976703946 4:88002331-88002353 TTGTGTCTATGGAAGGTTCCAGG + Intergenic
977282085 4:95052897-95052919 CTGTGTCTTAAGAATGTTCCAGG + Intronic
978194361 4:105953671-105953693 CTGTGTCTCTAAAAGCCTCTAGG + Intronic
978370791 4:108027825-108027847 CAGTGTCTCTAGGAGGGGTCGGG + Intronic
978379579 4:108112819-108112841 CTGTTTCTCTACAAGGGTATAGG - Intronic
979478889 4:121190903-121190925 CTTTTTCTCTACTAGGGTCCTGG - Intronic
980234194 4:130083428-130083450 CTGTGTCTCTACTAGGGAACAGG - Intergenic
980315896 4:131199881-131199903 CTGTCTCTATAAAAGGGTCTAGG - Intergenic
982098919 4:151949551-151949573 TTGTGCCTCTAAGAGGGTCCAGG + Intergenic
983119492 4:163863637-163863659 CTGTGTCACTTGACGGGTCCCGG + Intronic
985553991 5:547238-547260 CTGGGTCTCTAGGAGGGGGCGGG - Intergenic
989807409 5:45626449-45626471 CTCTGTCTCTAGTAGGATGCTGG - Intronic
995901942 5:117079887-117079909 GTGTGTCTTTAGCAGGGTCTGGG + Intergenic
998881704 5:146652025-146652047 GTGTGGCTGTAGAAGGGTCAGGG + Intronic
1002792943 6:448996-449018 CCATTTCTCTAGAAGGGTGCTGG - Intergenic
1007136791 6:39530146-39530168 CTGTGTATATAGAAAGGCCCAGG - Intronic
1009395092 6:63190410-63190432 CTGTGGCTCTGCAAGGCTCCAGG + Intergenic
1012954614 6:105555471-105555493 CTGTGTCTCTACTCGTGTCCAGG - Intergenic
1012998020 6:105992881-105992903 GTGTGTCTCCAGATGGGCCCAGG + Intergenic
1016902717 6:149117954-149117976 CTGTGTCACTAGCAGACTCCAGG - Intergenic
1017734198 6:157346121-157346143 CTGCCTCTCTAGGAGGGTCAGGG + Intergenic
1017852209 6:158314510-158314532 CTGTCTCTCTTAGAGGGTCCGGG + Intronic
1018149280 6:160923583-160923605 CTGAGGCTCTGGAAGGGCCCTGG - Intergenic
1018834678 6:167473980-167474002 CAGTCTTTCAAGAAGGGTCCCGG + Intergenic
1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG + Intronic
1019886911 7:3913212-3913234 CTGGTTCTCTAGATGGCTCCCGG + Intronic
1024122661 7:46260778-46260800 CTGTGTGTCTGGTAGGGTCAGGG - Intergenic
1025821145 7:64965771-64965793 TATTGTCTCTAGAAGGGTTCTGG - Intergenic
1032904204 7:136345744-136345766 CTGTGTCTCTTGAAGGGGAAAGG - Intergenic
1034501050 7:151451381-151451403 CTGAGGCTCTGGAAGGTTCCTGG + Intergenic
1035020500 7:155797449-155797471 CTGCTTCTCCAGAAGTGTCCCGG - Intergenic
1035134059 7:156683425-156683447 CTGTGGCTCTCTAAGGCTCCAGG + Exonic
1041714791 8:60923252-60923274 CTGTGTCTGCAGAGGGGCCCGGG - Intergenic
1041753922 8:61292037-61292059 CTGTGTCACTAACAAGGTCCTGG + Intronic
1042401219 8:68349586-68349608 TTGTGTTTCTATCAGGGTCCAGG + Intronic
1044634796 8:94311569-94311591 CTGTATGTCTAGAAGTTTCCTGG + Intergenic
1048163453 8:132041231-132041253 CTGTGTCTCTGGATGGATCCTGG + Intronic
1048604394 8:135952559-135952581 GTATCTCTCTAGAATGGTCCTGG + Intergenic
1048876034 8:138837645-138837667 CTCTGTGTCTGGAAGTGTCCTGG + Intronic
1049849525 8:144823329-144823351 CTGTGGCTCTTGGAGGCTCCTGG + Intergenic
1058344828 9:103948567-103948589 CTGTGTTTCTAGTAAGCTCCTGG - Intergenic
1058628592 9:106961785-106961807 ATGTGTATCTAGAAGGGTCAAGG + Intronic
1059683253 9:116606742-116606764 CTGTGTCTCAAGAACTGTGCTGG + Intronic
1061297082 9:129682570-129682592 CTTTGTCTCTTGACTGGTCCAGG + Intronic
1062123228 9:134845496-134845518 GTGGGTCTCCAGCAGGGTCCGGG + Intergenic
1062644881 9:137542794-137542816 CTCTGGCTCTTGCAGGGTCCTGG - Exonic
1190890273 X:54561439-54561461 CTGTGTCTCTGGAAGGTTCTAGG + Intergenic
1194340689 X:92701219-92701241 GTGTGTTTCTAGAAATGTCCAGG + Intergenic
1195348868 X:103978204-103978226 CTCTGTCTCTAGAAAGGAACAGG - Intergenic
1195358575 X:104060635-104060657 CTCTGTCTCTAGAAAGGAACAGG + Intergenic
1197647507 X:129033946-129033968 CTGTGTATGTAGGTGGGTCCAGG - Intergenic
1197878561 X:131139227-131139249 CTAGGTCTCTAGAAGGGTAGAGG - Intergenic
1199098474 X:143769241-143769263 CAGTGTCTCTAGAAAGGTTAGGG - Intergenic
1200649044 Y:5817957-5817979 GTGTGTTTCTAGAAATGTCCAGG + Intergenic
1200738377 Y:6826498-6826520 CTGTGTCTCTAGCAAGGCCAAGG + Intergenic