ID: 962742334

View in Genome Browser
Species Human (GRCh38)
Location 3:138370860-138370882
Sequence CTGGATCCACACCTGGCATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962742330_962742334 0 Left 962742330 3:138370837-138370859 CCATCTGCTAAAGTTCTTAATGC 0: 1
1: 0
2: 1
3: 7
4: 124
Right 962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG 0: 1
1: 0
2: 1
3: 11
4: 157
962742327_962742334 24 Left 962742327 3:138370813-138370835 CCCTGAAATCTGCCTTAGAGACA 0: 1
1: 0
2: 1
3: 12
4: 208
Right 962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG 0: 1
1: 0
2: 1
3: 11
4: 157
962742328_962742334 23 Left 962742328 3:138370814-138370836 CCTGAAATCTGCCTTAGAGACAA 0: 1
1: 0
2: 2
3: 17
4: 192
Right 962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG 0: 1
1: 0
2: 1
3: 11
4: 157
962742329_962742334 12 Left 962742329 3:138370825-138370847 CCTTAGAGACAACCATCTGCTAA 0: 1
1: 0
2: 1
3: 10
4: 121
Right 962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG 0: 1
1: 0
2: 1
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962742334 Original CRISPR CTGGATCCACACCTGGCATT AGG Intronic
903183365 1:21616401-21616423 CTAGAACCACACCTGGCACATGG - Intronic
903672037 1:25042147-25042169 CAGCATCCACAGCTGGCACTGGG + Intergenic
904368772 1:30035284-30035306 CTGGAGCCACCCAGGGCATTGGG + Intergenic
904704068 1:32377242-32377264 CTGGAAGCCCACCAGGCATTAGG - Intronic
905294394 1:36945047-36945069 CTGGCTCCACCCCTGGCCGTCGG + Intronic
907238128 1:53065204-53065226 GTGCCTCCACACCTGGCATCTGG - Intronic
907361323 1:53917883-53917905 CACGATCCACACATGGCATGTGG + Intronic
907876794 1:58497286-58497308 CATGATCCACACATTGCATTTGG - Intronic
911539969 1:99146468-99146490 CTGGATCCACAACTGCAATTTGG - Intergenic
919211664 1:194495102-194495124 CAGGTTCCTCACCTGACATTAGG + Intergenic
919470290 1:197970082-197970104 CTGGACCCACTCCTGAGATTAGG + Intergenic
919757431 1:201074732-201074754 CTGGATCCACACCTTCCCATGGG - Intronic
924679830 1:246220452-246220474 CTGGATCCACAGCTGTGGTTTGG - Intronic
1070020355 10:72579037-72579059 CTGGAACCAAACCTGCCATGAGG + Intronic
1070890707 10:79940662-79940684 CTGGACCCAGCACTGGCATTGGG - Intronic
1075964325 10:126598027-126598049 CTGGATGCCCACGAGGCATTTGG - Intronic
1078326729 11:10387349-10387371 CTGGATCCAGACACGGCAATTGG + Intronic
1079897832 11:26145107-26145129 CTGGATGGAAACCTGTCATTGGG - Intergenic
1080843066 11:36002636-36002658 CTGGAACCTCACTTGGCTTTAGG + Intronic
1081577765 11:44329923-44329945 CTGGAGTCACAGCTGGCACTTGG - Intergenic
1083190898 11:61051596-61051618 CTGGCTACACAACTGGCATGTGG + Intergenic
1083796900 11:65022052-65022074 CTGGCTCCTGACCTGGCCTTTGG + Exonic
1083892839 11:65605411-65605433 CAGGAAGCCCACCTGGCATTTGG - Intronic
1085045104 11:73348048-73348070 CTGGATGCACACATGGCCTGGGG + Intronic
1086956895 11:92942733-92942755 CGGGAGCTACACCAGGCATTGGG - Intergenic
1087037798 11:93772383-93772405 CTGCTTCCCCAGCTGGCATTGGG + Intronic
1089080080 11:115768343-115768365 CTGGATCCTAAGCTGGCATCAGG + Intergenic
1094427185 12:30327964-30327986 TTGGATCCACAGCTGCAATTTGG - Intergenic
1095270639 12:40214651-40214673 CTGCATCCACACATGGCAAAAGG - Intronic
1096608645 12:52786581-52786603 CTGGATCCTAAACTGGGATTTGG - Intergenic
1103723213 12:122985696-122985718 CTGGGCCCACACCTGGCACCAGG + Exonic
1103913567 12:124364703-124364725 CTGGCTCCCCACTTGGCATGAGG + Intronic
1111171611 13:84533922-84533944 CTGAATCTACACTTGTCATTTGG + Intergenic
1111307638 13:86435371-86435393 CTGGACCCACCCCTGACATGTGG - Intergenic
1114031463 14:18584016-18584038 CAGCAGCCCCACCTGGCATTCGG + Intergenic
1117235072 14:53765066-53765088 CTCTCTCCACACCTGACATTAGG - Intergenic
1119322117 14:73738521-73738543 GTGGAGCCACACCTGGCAGAGGG - Intronic
1122464641 14:101922947-101922969 CTGAAAGCACACCAGGCATTGGG - Intronic
1122762081 14:104036429-104036451 CAGGAACCACACGTGGCAGTGGG + Intronic
1123540057 15:21280950-21280972 CTGCATCCTCACATGGCATAAGG - Intergenic
1123859010 15:24444419-24444441 CTGGATTCATACATTGCATTAGG + Intergenic
1124094114 15:26632864-26632886 CTGGATTCATAACAGGCATTTGG + Intronic
1125552264 15:40554282-40554304 CAGGATGCACAGCTGCCATTAGG - Intronic
1125861334 15:43003888-43003910 ATGGATCCAGACTTGGCATATGG - Exonic
1128515862 15:68341570-68341592 CTGGACCCACAGCAGGCTTTGGG - Intronic
1128822809 15:70675870-70675892 CTGCATCCTCACCTGGCAGAAGG - Intronic
1129843611 15:78758336-78758358 CTGGATCCAACCCTGGCCTCTGG - Intergenic
1131465490 15:92652149-92652171 CTGGAACCACACTAGGTATTAGG + Intronic
1202948368 15_KI270727v1_random:8108-8130 CTGCATCCTCACATGGCATAAGG - Intergenic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1140212770 16:72983839-72983861 CTGTACCCACACTTGGCAGTGGG - Intronic
1140475844 16:75238887-75238909 CTGGGTCCCCACCTGCCTTTGGG - Intronic
1141853350 16:86663692-86663714 CAAGATCCTCATCTGGCATTGGG + Intergenic
1141886086 16:86893370-86893392 CTGGAAGCACACCTTGCATTTGG - Intergenic
1142491431 17:282163-282185 CTGGACCCTCCCCTGGCATTGGG - Intronic
1144352202 17:14408023-14408045 CTGTATCCACACCTAGCTGTTGG + Intergenic
1146717891 17:35101492-35101514 CTAGTTCCAGACCTGCCATTAGG - Intronic
1149358475 17:55868900-55868922 CTAGATCCACATCTAACATTGGG + Intergenic
1151004201 17:70414722-70414744 CTGGATCCAGACATGTCATTTGG - Intergenic
1157288562 18:46393932-46393954 CAGGATCCCCACCAGGCAGTGGG - Intronic
1157309401 18:46540818-46540840 CTGGATCCAGGGCTGGCTTTGGG + Intronic
1159925729 18:74267771-74267793 GTGGATCCACAGCTTCCATTTGG - Intronic
1165319577 19:35076930-35076952 CTGGAGCCACAGCTGCCATCTGG - Intergenic
1166862950 19:45820153-45820175 CTGGGTCCACAAATGGCCTTGGG + Intronic
927200542 2:20575584-20575606 CTGGCTCCTCACCTGGCATGTGG - Intronic
927217728 2:20677945-20677967 CTGGATCCTCCCCTGGCCTGGGG + Intergenic
927766929 2:25819052-25819074 CTGGATTCTTAGCTGGCATTTGG - Intronic
930979998 2:57512787-57512809 GTGTATCCACACCTCTCATTCGG - Intergenic
932593243 2:73079639-73079661 GTGGATGCTCACCTGGCACTGGG + Intronic
932863311 2:75316667-75316689 CTGGATCCACTCCTGCAATTAGG - Intergenic
933865581 2:86513779-86513801 CTGCAGCAACACCTGGCATCAGG + Intronic
938242544 2:129754593-129754615 CGGGCGCCGCACCTGGCATTCGG - Intergenic
941397272 2:164989473-164989495 CTGCATCCTCACATGGCATAAGG - Intergenic
942472517 2:176275811-176275833 CTGGAGCCACTCCTGGCACAGGG - Intronic
945095929 2:206219258-206219280 CTGAATCAACACATGGCATCGGG - Intergenic
945976641 2:216276260-216276282 ATGGAGACACACCTGGCTTTTGG + Intronic
947941563 2:234060565-234060587 CTGGATCATCACCTGGGCTTGGG + Intronic
1173607952 20:44345325-44345347 CTGGGGCAACACCTGGCATCGGG + Exonic
1175521060 20:59603296-59603318 CAGGCACCACACCAGGCATTAGG - Intronic
1177203514 21:17984373-17984395 TTGGATCCACACCCAGAATTGGG + Intronic
1177310343 21:19384119-19384141 CTGTATCCTCACCTGGCAGTAGG - Intergenic
1179136670 21:38685646-38685668 CTGGGAGCACACCTGGCCTTCGG - Intergenic
1179177626 21:39020770-39020792 CTGGATGGAGACCTGGGATTTGG - Intergenic
1181106710 22:20579947-20579969 CTGAAGACACAACTGGCATTAGG - Intronic
1181789938 22:25257260-25257282 CTGGGTGCAGAGCTGGCATTGGG - Intergenic
1181824733 22:25505951-25505973 CTGGGTGCAGAGCTGGCATTGGG - Intergenic
1182951824 22:34383275-34383297 CTGGAACCATTCCTGCCATTTGG + Intergenic
1183185551 22:36289624-36289646 CCTGAACCACAGCTGGCATTTGG + Intronic
950626197 3:14248899-14248921 CCTGATGCACACCAGGCATTGGG - Intergenic
950626677 3:14252632-14252654 CTGGGGCCACACATGGCAATCGG - Intergenic
959705046 3:109331859-109331881 CTGGGACCTCACCTGGCCTTTGG + Exonic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961938153 3:130608004-130608026 CTGCATCCACACATGGCAGAAGG + Intronic
962445836 3:135463827-135463849 CTGCATCCACACATGACATAAGG - Intergenic
962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG + Intronic
962753359 3:138450772-138450794 CTGGCTCAGGACCTGGCATTTGG + Intronic
965921762 3:173925591-173925613 CTGGTTCCACACCCAGCAATTGG - Intronic
966153135 3:176887671-176887693 TTGGGTACACACCTGGCAGTGGG - Intergenic
967643864 3:191899068-191899090 CCCCATCCACTCCTGGCATTAGG - Intergenic
967986641 3:195100276-195100298 CTGCCTCCACACCTAGCATGGGG + Intronic
968435912 4:589129-589151 CTGGCTCCTCAGCTTGCATTCGG - Intergenic
971200870 4:24508093-24508115 CTGGATTCACTCCTTGCCTTTGG - Intergenic
971230733 4:24798938-24798960 CTGGGCCCACACCTGGCAAAAGG - Intronic
971752775 4:30672505-30672527 CAAGATCCACAGCTGACATTAGG - Intergenic
971869300 4:32215588-32215610 CAGCTTCCACAGCTGGCATTGGG + Intergenic
975120191 4:70719856-70719878 CTGGATCACTACCTGGCATGTGG + Intronic
976886652 4:89992909-89992931 GTAGATTCACATCTGGCATTTGG + Intergenic
979077786 4:116296780-116296802 CTGAAACCATACCTGGCATCTGG + Intergenic
980556387 4:134411235-134411257 CTGGAACCACACCTTCCATGTGG + Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
983969272 4:173851176-173851198 CTGCATCCACACATGGCAGGAGG - Intergenic
984714835 4:182916661-182916683 CTGGTTTCCCACCTGGCTTTAGG + Intronic
986231425 5:5867693-5867715 CTGCACCCACACCTGGATTTAGG + Intergenic
986535869 5:8786372-8786394 CTGAGTCCACACCTTGCTTTCGG - Intergenic
987926326 5:24346475-24346497 CTGCAGCCAAACCTGGCCTTCGG - Intergenic
989209013 5:38841654-38841676 CTGTGTCCCCACCTGGCACTTGG - Intergenic
991731772 5:69596668-69596690 CTGGATCCAAAGCAGGCACTAGG - Intergenic
991808204 5:70451806-70451828 CTGGATCCAAAGCAGGCACTAGG - Intergenic
991863180 5:71031199-71031221 CTGGATCCAAAGCAGGCACTAGG + Intergenic
993748293 5:91630246-91630268 CTGGATCCTCACATGGCAGAGGG - Intergenic
994100752 5:95889935-95889957 CTGGATCCATGCCTGGTACTTGG - Intronic
998866994 5:146515479-146515501 CTCTACCCACTCCTGGCATTTGG - Exonic
1001268761 5:170295099-170295121 CTGGGACCCCACCTGGGATTAGG + Intronic
1001280061 5:170380417-170380439 CTGGCTCAACACCTGCCATTTGG - Intronic
1004169863 6:13287550-13287572 CTGGCTCCAGACATGACATTTGG + Exonic
1004884613 6:20039590-20039612 CTAGAGCCACATCTGGCCTTAGG - Intergenic
1005814396 6:29538978-29539000 ATGGATACACACCTGGTGTTGGG - Intergenic
1006135451 6:31893012-31893034 CTGGAGCCTCACATGGCATTTGG - Intronic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1008054024 6:46928128-46928150 CAGGATTCACAGCAGGCATTTGG - Intronic
1008752761 6:54757277-54757299 CTGGACTCACACCTGGCCTCGGG - Intergenic
1011787163 6:90859817-90859839 CAGCATCCCCGCCTGGCATTTGG - Intergenic
1013925553 6:115467888-115467910 CTGGATCCACACAGGGCCTGGGG - Intergenic
1014259132 6:119196081-119196103 CAGGATCCAGACGTGTCATTTGG + Intronic
1016505953 6:144779146-144779168 TTGGATCCCCACATGGCATCAGG - Intronic
1017590751 6:155975831-155975853 CTGGGTACACAACTGGCTTTTGG + Intergenic
1019770838 7:2882895-2882917 GTGGAGCCTCACCTGGCACTTGG - Intergenic
1024326422 7:48112925-48112947 CTGTGTCCTCATCTGGCATTTGG - Intergenic
1025952767 7:66158470-66158492 CTGGATCCTCACATGGCACAAGG - Intergenic
1026319152 7:69253956-69253978 CTGTATCCACTGCTGTCATTTGG + Intergenic
1028726172 7:94090354-94090376 CTCCATCCACACAGGGCATTTGG - Intergenic
1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG + Intronic
1032529174 7:132605893-132605915 CTGGAACCACAGCCGGCCTTTGG - Intronic
1032592929 7:133208935-133208957 CAAGATTCACACCTTGCATTTGG - Intergenic
1033820282 7:145126522-145126544 CTGGTTCCACCCTTGGCACTCGG - Intergenic
1034841656 7:154403328-154403350 CTGAATCGCCACTTGGCATTTGG - Intronic
1035422573 7:158741729-158741751 CTCCATCCACACCAGTCATTGGG - Exonic
1038046128 8:23766972-23766994 CTGCAGCCACACTGGGCATTTGG + Intergenic
1041711423 8:60898187-60898209 CTGGATCCACACCTGGCACCTGG - Intergenic
1043438584 8:80257258-80257280 CAGGAGCCCCACCTGGCATTGGG - Intergenic
1047349672 8:124061775-124061797 CTGGATGCCCAGCTGGCTTTGGG + Intronic
1048044321 8:130759045-130759067 CTGGCTCCACCACTGGCATCAGG + Intergenic
1049579612 8:143405341-143405363 CAGGCTGCACACCTGGCATCAGG - Intergenic
1052265809 9:26571862-26571884 CTGGCTCCAAATCTGTCATTAGG + Intergenic
1052610123 9:30760606-30760628 ATGGATCCACAACTGAAATTTGG + Intergenic
1053504962 9:38634504-38634526 CTGGATTCTCAACAGGCATTTGG + Intergenic
1055696465 9:78890238-78890260 CTGTATCCAGACATTGCATTTGG - Intergenic
1055772153 9:79728960-79728982 ATGGATACACACCTCGCTTTGGG + Intergenic
1058581830 9:106466977-106466999 CTGGATTCACACCTGGCTCCAGG + Intergenic
1062026946 9:134344901-134344923 CTGGGTCCACACCAGGCACAGGG - Intronic
1062080296 9:134620131-134620153 CTGCACCAACACCTGGCATCTGG + Intergenic
1185669162 X:1792173-1792195 ATGGGTCCACAACTGGGATTTGG - Intergenic
1185674420 X:1837325-1837347 CTGGTTCCACCCATGGCATGTGG + Intergenic
1185674470 X:1837621-1837643 CTGGTTCCACCCATGGCATGTGG + Intergenic
1185836020 X:3346503-3346525 CTGGGTCCTCACCTGTCCTTGGG + Exonic
1186462477 X:9759415-9759437 CTGGATCCACATCTGCAATCGGG + Exonic
1190441852 X:50482603-50482625 CTGAATCCAAAACTGGCATTGGG - Intergenic
1191109494 X:56793758-56793780 CTGGCTCCACAGCTGTCTTTAGG + Intergenic
1191933237 X:66396820-66396842 CTGGATCCACAGCTTGCAGATGG + Intergenic
1195199996 X:102539477-102539499 CTGGATCCACATGGGGCCTTGGG - Intergenic