ID: 962742445

View in Genome Browser
Species Human (GRCh38)
Location 3:138371770-138371792
Sequence GTTAAACACAGGTGCAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962742445_962742450 13 Left 962742445 3:138371770-138371792 CCCTAGCTGCACCTGTGTTTAAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 962742450 3:138371806-138371828 AGCCTCCTTCTGGAAACTCTTGG 0: 1
1: 0
2: 1
3: 37
4: 307
962742445_962742449 3 Left 962742445 3:138371770-138371792 CCCTAGCTGCACCTGTGTTTAAC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 962742449 3:138371796-138371818 TGGTGCTGTCAGCCTCCTTCTGG 0: 1
1: 0
2: 1
3: 20
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962742445 Original CRISPR GTTAAACACAGGTGCAGCTA GGG (reversed) Intronic
906779177 1:48557156-48557178 GTTAAACACAGGGGAAATTATGG - Intronic
908085122 1:60623781-60623803 ATTAAAAACAGTTGCATCTAAGG + Intergenic
923729072 1:236533120-236533142 GTTAAAGAAAGGTACAGCCAGGG - Intronic
1067161612 10:43830144-43830166 GTTAAAAACAGATCCAGCCATGG + Intergenic
1068549773 10:58393322-58393344 GTGTAAAACAGGTGAAGCTAAGG - Intronic
1073638146 10:105220488-105220510 GTTAAGCAATGATGCAGCTATGG - Intronic
1073853246 10:107645482-107645504 GTTAAACACATGTACTGCGAAGG + Intergenic
1075180829 10:120209478-120209500 GTAAAACACAGCTGCAGGAAAGG - Intergenic
1075730960 10:124636620-124636642 GGACAAGACAGGTGCAGCTAAGG - Intronic
1079324772 11:19482305-19482327 GCTCAACACAGGAGCAGCAAGGG - Intronic
1089865807 11:121630246-121630268 GTTCAACAGAGCTGCAGCTTGGG + Exonic
1094837551 12:34329187-34329209 GAAAAACAAAGGTGCAGCTGAGG - Intergenic
1096280228 12:50246319-50246341 GTTAAAGACAGGTGGGGCTAAGG + Intronic
1096630299 12:52922127-52922149 GTTACTCACAGGTGCAATTATGG - Intronic
1099643974 12:85326791-85326813 GTTAAACACATGTGGAGGGAAGG + Intergenic
1104823981 12:131695305-131695327 GTTAAGCTCAGGTGCCGCCAGGG - Intergenic
1106932968 13:34686889-34686911 GTTAAAAACAGGAGAAGTTAGGG + Intergenic
1112133680 13:96552336-96552358 GATCAACACAGGGGCAGCTATGG + Intronic
1115151934 14:30295991-30296013 GTTCAACACAACTGCAGCTATGG - Intergenic
1116369224 14:44108766-44108788 CTTTAACACATGTGCAGCAAGGG + Intergenic
1116586120 14:46706928-46706950 CTTAAATACAGGTCAAGCTAAGG + Intergenic
1117996208 14:61480619-61480641 GGGTAAAACAGGTGCAGCTATGG - Intronic
1118127313 14:62921199-62921221 ATTAAACACAGTTGCAGGAATGG + Intronic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1122809978 14:104283070-104283092 GTTAAACACAGGAGCAGGGCTGG + Intergenic
1125363581 15:38889950-38889972 GTCAAACAGAGGTGGACCTACGG - Intergenic
1125782720 15:42284690-42284712 GTTACTCACAGGTGCAGTCATGG + Intronic
1129884464 15:79028872-79028894 GTTAAGCACAGATCCAGCTCCGG - Intronic
1134017872 16:10901895-10901917 GATCAACACAGCTGCAGCCAGGG + Intronic
1134478949 16:14601030-14601052 GTTAAACAGTGCAGCAGCTAAGG + Intronic
1135034087 16:19061973-19061995 GGTAAACACAGCTGCACATATGG - Exonic
1140052219 16:71491904-71491926 TTTAAAAACAGGTAAAGCTAAGG - Intronic
1140836939 16:78803601-78803623 GTTAAAAACATGTCCAGGTATGG - Intronic
1154138881 18:11805376-11805398 GTAAAGTACAGGTGCAGCTTGGG + Intronic
1157667685 18:49501462-49501484 GTTATACACTGGTCCAGCCAGGG - Intergenic
1158934975 18:62356177-62356199 GTTAAAACCAGGTGCCTCTAAGG - Intronic
1164368845 19:27622647-27622669 GATAAACACACGTGCAGTCAAGG - Intergenic
1164545185 19:29154733-29154755 GTTAAAGACAGATACAGCTTTGG + Intergenic
926806340 2:16715461-16715483 GTTAAACACAGAGGCAGGTCCGG - Intergenic
936037398 2:109123788-109123810 GTCCAAAACAGGTGCAGCCATGG - Intergenic
937344072 2:121112530-121112552 GTTGAACACTGGTGCAGTTATGG - Intergenic
940202938 2:151171336-151171358 GTTTAACAGTGGTGTAGCTATGG - Intergenic
942240158 2:173955602-173955624 GATAAACACAGGACAAGCTATGG - Exonic
946782668 2:223206635-223206657 GTTAATTACAGGTACATCTATGG + Intergenic
948727221 2:239942272-239942294 GCTAAACACAGATGCTGCTGGGG + Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171006107 20:21467220-21467242 GTTAATCCAATGTGCAGCTAAGG + Intergenic
1172075160 20:32290474-32290496 GTTAAATACAGGTTTTGCTATGG + Intronic
1172952928 20:38733559-38733581 GGTAAACTTAGGTGCATCTAGGG - Intergenic
1175604586 20:60302224-60302246 GTGAGAGACAGGTGCAGTTAGGG - Intergenic
1184102524 22:42348287-42348309 GGTGAACCCAGGTGCAGCTCTGG - Intergenic
960168121 3:114427143-114427165 GTTACACTCAGATGCTGCTATGG - Intronic
961493802 3:127275962-127275984 GTCATAAACAGGTGAAGCTATGG - Intergenic
962742445 3:138371770-138371792 GTTAAACACAGGTGCAGCTAGGG - Intronic
962889294 3:139657475-139657497 GTTCAACAGAGGTGCATCTTAGG + Intronic
965584215 3:170301391-170301413 GTTAAACAGAAATGCAGCTCAGG - Intronic
966672832 3:182547771-182547793 GTTACACACACCTGCAGCGACGG + Intergenic
970104456 4:12565321-12565343 CTTAAACTTGGGTGCAGCTAAGG + Intergenic
975586093 4:75951028-75951050 GCTCAAAACAGGAGCAGCTATGG + Intronic
980368102 4:131832474-131832496 CTCAAACCCAGGTGCTGCTATGG - Intergenic
982205792 4:152996326-152996348 GTTGAACGCAGGTGCAGCCTCGG + Intergenic
983160065 4:164402227-164402249 GTTCAACACAGGTTCAGCAATGG + Intergenic
986448340 5:7842752-7842774 GTTAAACATAGGTGCACCAACGG - Intronic
992607717 5:78476742-78476764 GTGAAAGACAGGTGCATTTAGGG - Exonic
994665277 5:102697302-102697324 GTAAAACACAGGTGTATCTGGGG - Intergenic
996019564 5:118576673-118576695 GTTAGACAGGAGTGCAGCTATGG + Intergenic
996699256 5:126433595-126433617 GTTAAACACAGGTACCTCTTTGG + Intronic
996846041 5:127899983-127900005 GCTAAACACAGGTGAAGGCAGGG - Intergenic
997425773 5:133801668-133801690 GTTCAGCCCAGGTGCAGTTAGGG + Intergenic
1004263630 6:14130174-14130196 GGGAAACTCAGGTGCTGCTAGGG + Intronic
1007912117 6:45526200-45526222 CTTAAAGACAGGTTCAGCTGTGG - Intronic
1008878128 6:56351587-56351609 ATTATACACATGTGCAGCTTGGG - Intronic
1009311477 6:62158451-62158473 GTTAAACGATAGTGCAGCTATGG + Intronic
1013163022 6:107564386-107564408 TTAAAACACAGCTGCAGCTCTGG - Intronic
1015981993 6:138848686-138848708 GTTAAACACTGTGGAAGCTATGG - Intronic
1023738350 7:43254707-43254729 ATTAAACTGAGGTGCAGCTGAGG - Intronic
1024882348 7:54102479-54102501 GTTAAATACATGTGTAGATATGG - Intergenic
1026161353 7:67871578-67871600 AATACAAACAGGTGCAGCTATGG - Intergenic
1028821822 7:95220502-95220524 GTGAAACACAGCTGCAGCTGGGG - Intronic
1034669717 7:152848837-152848859 ATCAACCACAGCTGCAGCTACGG - Intronic
1035988135 8:4457192-4457214 GTTAAACACATGTGGAGGGAAGG + Intronic
1036556219 8:9862538-9862560 GTTATTCACAGGTGCAGTCATGG + Intergenic
1036783441 8:11667598-11667620 GCTATTCACAGGTGCAGTTATGG - Intergenic
1039736654 8:40339822-40339844 TTTAAACACATGTGAGGCTAGGG - Intergenic
1041921589 8:63188183-63188205 GCTATTCACAGGTGCAGTTATGG + Intronic
1043968360 8:86504506-86504528 ATTAAACACACGTGCACCAATGG - Intronic
1046028897 8:108759730-108759752 GTTAAAGACAGATGCTTCTATGG + Intronic
1053887310 9:42653790-42653812 GTTACACACACGTGCAGCCTGGG - Intergenic
1054226332 9:62461241-62461263 GTTACACACACGTGCAGCCTGGG - Intergenic
1056111215 9:83396924-83396946 GTGAAACACAGTTGCAGAGATGG + Intronic
1058250626 9:102691471-102691493 ATTAAACACATCTGCTGCTATGG - Intergenic
1058573818 9:106378630-106378652 GTTAAGCACAGGTACAGAGAAGG + Intergenic
1186094709 X:6087139-6087161 CTTAAATATAGGTGCAGTTATGG + Intronic
1187632261 X:21186552-21186574 GTTAACCACAGTTCCAGCTGGGG - Intergenic
1199501148 X:148507627-148507649 GTTAAACAAAGGTCCAGCCCTGG + Intronic