ID: 962743837

View in Genome Browser
Species Human (GRCh38)
Location 3:138382869-138382891
Sequence CTGGTGTGCTTGGCCCAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962743837_962743843 22 Left 962743837 3:138382869-138382891 CCAGTTTGGGCCAAGCACACCAG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 962743843 3:138382914-138382936 TCCCCTGTCTGCCATTGTGTTGG 0: 1
1: 0
2: 0
3: 10
4: 200
962743837_962743845 23 Left 962743837 3:138382869-138382891 CCAGTTTGGGCCAAGCACACCAG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 962743845 3:138382915-138382937 CCCCTGTCTGCCATTGTGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962743837 Original CRISPR CTGGTGTGCTTGGCCCAAAC TGG (reversed) Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
901471420 1:9459360-9459382 CCACTGTGCTTGGCCCAAAATGG - Intergenic
901672392 1:10863466-10863488 CTGGTGTACTTGCCCCGACCTGG + Intergenic
903946478 1:26967059-26967081 CTGGTGTGCTTCTCCCATAAGGG + Intergenic
912398246 1:109365941-109365963 CTGCTGTTCTTGGCCCAAGTGGG - Intronic
912561401 1:110554266-110554288 CCTGTTTCCTTGGCCCAAACTGG + Intergenic
918008970 1:180568677-180568699 CTGGTGTGGTTGGCAGTAACAGG + Intergenic
1064297195 10:14089326-14089348 CTGGTGGGCTGGGCCCCAGCGGG - Intronic
1064831781 10:19476578-19476600 CTGGTGTGCTTACCCCAGGCTGG + Intronic
1074284193 10:112082508-112082530 CTGATGTGCTTTCCCAAAACAGG - Intergenic
1075310856 10:121412441-121412463 CTTGTGTACTTGGCCCCAAAGGG - Intergenic
1075713657 10:124543656-124543678 CTGCTGTGCTGGGCCCAGACAGG - Intronic
1076612912 10:131737650-131737672 CTGGAGCTCTTGGCCTAAACAGG + Intergenic
1077266603 11:1653807-1653829 CAGGTGGGCCTGGCCCACACTGG - Intergenic
1077719485 11:4613355-4613377 CTGGGGTGCTTGGAACAAAATGG - Intergenic
1080593337 11:33743638-33743660 TTGGTGTGCTTGACCCAAGGAGG - Intronic
1081658795 11:44875136-44875158 CTGGTGTTCTAGGCCCACATGGG - Intronic
1083193807 11:61071232-61071254 CTGGTGGGCTTGGCCCATCGGGG - Intergenic
1083709387 11:64538876-64538898 CTGGTGTGCTTGTCACCACCTGG + Intergenic
1083812066 11:65111803-65111825 CTGGTGTGCTGGGCCCAGCATGG + Exonic
1085158780 11:74321871-74321893 CTGCTGTGCTTGGCCCCAGAGGG + Intergenic
1090585402 11:128206631-128206653 ATGGTTTGCTTGGCCCCACCAGG + Intergenic
1091749830 12:3015265-3015287 CAGGTGAGCTTGGACCAGACTGG - Intronic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1098907956 12:76180841-76180863 CTGCTCTTCTTGGCCCACACTGG - Intergenic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1101003171 12:100376451-100376473 CTGGTGTGCTGGGAACACACAGG + Intronic
1107525087 13:41222550-41222572 CAGGTGAGCTTGACCTAAACAGG + Intronic
1111945466 13:94660451-94660473 CAGGTAGGTTTGGCCCAAACTGG - Intergenic
1112843194 13:103605920-103605942 CTGTTGTGCCTGGCCCATGCTGG - Intergenic
1114730267 14:24985743-24985765 CTGGTGTGTAAGGCCCAAAAGGG - Intronic
1121312796 14:92944239-92944261 CTGCTCTGCTTGGCCCCAAAAGG + Intronic
1124593069 15:31070307-31070329 CAGGTGAGTTGGGCCCAAACAGG + Intronic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1128788067 15:70412840-70412862 GTGGTGAGCATGGCCTAAACAGG + Intergenic
1129348905 15:74942616-74942638 CTGGTGGGCTTGACCTAATCAGG - Intergenic
1129450679 15:75649497-75649519 CTGGTGGGCTGGGCACCAACGGG + Exonic
1133139923 16:3736203-3736225 CTGTTGTGCTTTGCCCACTCAGG - Exonic
1134517442 16:14898544-14898566 CTGGTGTGCTTGATCCAGAGAGG - Intronic
1134705110 16:16297195-16297217 CTGGTGTGCTTGATCCAGAGAGG - Intergenic
1134962431 16:18414919-18414941 CTGGTGTGCTTGATCCAGAGAGG + Intergenic
1134966728 16:18497518-18497540 CTGGTGTGCTTGATCCAGAGAGG + Intronic
1137557913 16:49484318-49484340 TTGGTGTTATTTGCCCAAACAGG - Intergenic
1139595324 16:67954440-67954462 CTGCCTTGCCTGGCCCAAACTGG + Intronic
1142103985 16:88292218-88292240 CTGGTGTGCGTGGTCCCAGCAGG + Intergenic
1142129413 16:88425911-88425933 CTGGAGACCTTGGCCCAAATTGG + Intergenic
1152226545 17:79095431-79095453 CTGGGGAGCTGGGCCCAGACAGG - Intronic
1153944991 18:10010135-10010157 CTGGAGAGCTTGGCACATACTGG + Intergenic
1155026317 18:21943963-21943985 CTGATTTGCTTGGACCAATCAGG + Intergenic
1157171656 18:45412456-45412478 CTGATATTCTTGGCTCAAACTGG + Intronic
1159793820 18:72817341-72817363 CTGGTGTTCTTGGCCATAGCTGG - Intronic
1161566225 19:5004351-5004373 CTGGAGTGCATGGCCCACAGTGG + Intronic
1163366020 19:16876593-16876615 CTGGTATGCGTGGCACAGACTGG - Intronic
1164886286 19:31781551-31781573 CAGGGATGCTTGTCCCAAACTGG - Intergenic
1167622279 19:50566908-50566930 CTGGGGTGCAAGGCCCAAAGAGG + Intronic
925754234 2:7118679-7118701 CTGGTGAGCCTGGAGCAAACAGG + Intergenic
925835012 2:7936001-7936023 CTGGTGTATTTGGCCCAACAAGG + Intergenic
928119503 2:28573356-28573378 GGGGTGGGCTTGGCCTAAACTGG + Intronic
928569776 2:32594037-32594059 CTGATTTGCTTGCCGCAAACTGG - Exonic
931797295 2:65723422-65723444 CTTGTGTGCTGGGTCCAATCTGG - Intergenic
938992737 2:136645955-136645977 CTGGTGTGGTTGGAACAAAGGGG + Intergenic
945491920 2:210466230-210466252 GTGGTCTACTTGCCCCAAACAGG + Intronic
1181577122 22:23802215-23802237 CTGGGGTGCCAGGCCCAACCTGG + Intronic
1182697581 22:32206996-32207018 CTGGTGAACTTGGGCCAAAAAGG + Intergenic
949576447 3:5343205-5343227 CTGGGGTGCTTGACACAGACTGG + Intergenic
950202249 3:11053109-11053131 CTGGTGTTCTCGGCCACAACTGG + Intergenic
953856172 3:46500680-46500702 CTTCTGTGCTGGGCCCATACAGG + Exonic
956684426 3:71811118-71811140 CCGCAGTGCTTGGCCCAAAGTGG + Intergenic
962743837 3:138382869-138382891 CTGGTGTGCTTGGCCCAAACTGG - Intronic
962836930 3:139197863-139197885 CTTGTGTACATGGCCCAATCTGG - Intronic
969659912 4:8520619-8520641 TTGTTGGGCTTTGCCCAAACAGG - Intergenic
980768599 4:137341590-137341612 CTGGTGAGCTTAGAGCAAACAGG - Intergenic
985698768 5:1358225-1358247 CTGGTCCGCTTGGCCCACAGGGG - Intergenic
989189569 5:38657215-38657237 CTGATTTGCTTGGCACATACTGG - Intergenic
994468169 5:100165481-100165503 ATGGTGTGCATGACTCAAACTGG + Intergenic
995491235 5:112693463-112693485 CTGATGTGCTTGGAAAAAACCGG + Intergenic
1001931242 5:175674562-175674584 CTGGTGTTGTTGGCACAGACTGG - Intronic
1003375698 6:5575109-5575131 CTGGTGTCCTTAGCCCAAGAAGG - Intronic
1014698605 6:124655548-124655570 CTGGTGTGCTTGGGACTAAGGGG + Intronic
1016360442 6:143261501-143261523 CTGGTGGCCTTGGCCTAAGCAGG + Intronic
1024615465 7:51108148-51108170 TTGGTGAGCTTGGCCCACAGTGG - Intronic
1025782613 7:64615278-64615300 CTGGTGGGCTAGGCCCAGGCTGG - Intergenic
1026995985 7:74617115-74617137 CTGGTGGCCTGGGCTCAAACTGG - Intergenic
1032072914 7:128820398-128820420 CTGGTGTGGGTGTCCCAAAGGGG - Intronic
1038313588 8:26464559-26464581 CTGGTGAGGTTGGCTCAAGCTGG - Intronic
1038648079 8:29377861-29377883 CTGGTGTCCTGGGCCCAGCCAGG - Intergenic
1048811194 8:138288203-138288225 TTGTTGTGCTTGGTACAAACTGG - Intronic
1049385882 8:142342761-142342783 CTGCTGTGGTGGGCCCAGACAGG - Intronic
1050212129 9:3272159-3272181 CATGTGTTCTTGGCACAAACAGG - Intronic
1056541908 9:87578959-87578981 CTGGTGTGCATGGCACAAAGAGG - Intronic
1056571869 9:87824208-87824230 CAGGTGTTCATGGCCCAACCAGG - Intergenic
1058574058 9:106381101-106381123 ATGGTGGGCTTGGCACAACCTGG - Intergenic
1059334072 9:113557671-113557693 TTGGTGTCCTTGCCCCACACTGG - Intronic
1187521012 X:20014038-20014060 ATGGTGTCCTAGGCCCAACCTGG - Intronic
1200817963 Y:7553469-7553491 CTTGTGTGCTTTTGCCAAACTGG + Intergenic