ID: 962744862

View in Genome Browser
Species Human (GRCh38)
Location 3:138389689-138389711
Sequence TAGTGGGTCCCTTTAACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962744859_962744862 -7 Left 962744859 3:138389673-138389695 CCTGGTGCATGGCCTTTAGTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
Right 962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 86
962744857_962744862 0 Left 962744857 3:138389666-138389688 CCTTCTTCCTGGTGCATGGCCTT 0: 1
1: 0
2: 5
3: 39
4: 334
Right 962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 86
962744853_962744862 20 Left 962744853 3:138389646-138389668 CCTTAGGGAAATAGGAACACCCT 0: 1
1: 0
2: 0
3: 6
4: 146
Right 962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 86
962744856_962744862 1 Left 962744856 3:138389665-138389687 CCCTTCTTCCTGGTGCATGGCCT 0: 1
1: 0
2: 3
3: 30
4: 305
Right 962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 86
962744852_962744862 27 Left 962744852 3:138389639-138389661 CCTTGGGCCTTAGGGAAATAGGA 0: 1
1: 0
2: 1
3: 18
4: 171
Right 962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 86
962744850_962744862 28 Left 962744850 3:138389638-138389660 CCCTTGGGCCTTAGGGAAATAGG 0: 1
1: 0
2: 1
3: 12
4: 132
Right 962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962744862 Original CRISPR TAGTGGGTCCCTTTAACTCC TGG Intronic
901951835 1:12755623-12755645 TGCTGGGTCCCCTTACCTCCTGG - Intronic
902593409 1:17491288-17491310 TAGTGGATGCCTGTAACCCCAGG - Intergenic
912578819 1:110701831-110701853 TGATGGGTCCATTTAACTGCAGG - Intergenic
915105503 1:153533135-153533157 TAGGGGGATCCTTTAGCTCCCGG - Intergenic
923229052 1:231966592-231966614 TAGTGGTTCCATTTAACTGATGG + Intronic
924711060 1:246530424-246530446 TAGTGGCTCCAGTTAACTTCCGG - Intergenic
1064352417 10:14588531-14588553 AAGTGGGTCCCATAAACCCCCGG + Intronic
1064570237 10:16685115-16685137 TAGTGTGTGCCTGTAACCCCAGG + Intronic
1065351977 10:24803993-24804015 TGGTGGGTGCCTGTAATTCCAGG - Intergenic
1069043989 10:63723400-63723422 TAGTGGGTCTCTTTGGCTTCAGG + Intergenic
1073528322 10:104207039-104207061 TAGTGTGTGCCTATAATTCCAGG + Intronic
1074102746 10:110366367-110366389 TAGTGGTTCCCTTTGTCTCAGGG - Intergenic
1074311984 10:112329988-112330010 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1075684777 10:124355868-124355890 TGGTGGGCGCCTGTAACTCCAGG + Intergenic
1084543404 11:69801285-69801307 TAGTGGGTGCCTTTCCCACCTGG - Intergenic
1087659702 11:100972594-100972616 CAGTGGGTTCCTTGAGCTCCTGG - Intronic
1088523857 11:110730121-110730143 TGGTGGGTGCCTGTAACTCCAGG + Intergenic
1089538335 11:119174154-119174176 TCCTGGGTTACTTTAACTCCTGG + Intronic
1089992093 11:122870944-122870966 TAGTGTGTGCCTGTAATTCCAGG + Intronic
1092234312 12:6796655-6796677 CAGTGGGTCCCCTCACCTCCAGG + Intronic
1096195666 12:49647454-49647476 CAGTGGGACCCGCTAACTCCAGG + Intronic
1099585130 12:84505586-84505608 AAGAGGGTCCCTTCAACTCAAGG + Intergenic
1102154328 12:110712505-110712527 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1102331001 12:112030506-112030528 TAGTTGGTCTCTTGAACTCAGGG - Intronic
1108884424 13:55162480-55162502 TAGTTGGTCTCTTTAACTTTTGG + Intergenic
1109762442 13:66847390-66847412 TAGTGGGTGCCTGAAACTGCAGG + Intronic
1112565944 13:100551615-100551637 GAGTGGGTCCCCTAAAATCCAGG + Intronic
1120806413 14:88755922-88755944 TCCTGGGTTCCTTGAACTCCTGG - Intronic
1123433659 15:20239090-20239112 TAGTGGGTGCCTATAACTCCAGG + Intergenic
1126406498 15:48328330-48328352 TGGCGGGTCTCTTGAACTCCTGG - Intergenic
1127675080 15:61230347-61230369 TAGTAGGTACCTAAAACTCCAGG + Intergenic
1138061570 16:53896804-53896826 TTGTGAGTCCCTTTAGCTCCTGG - Intronic
1139353277 16:66351219-66351241 TGCTGGGACCCTTTATCTCCTGG - Intergenic
1139867814 16:70077463-70077485 TAGTGGGCGCCTGTAACCCCAGG - Intergenic
1140821099 16:78664132-78664154 TAGTTGCTCTCTTTAACTCCAGG - Intronic
1142316060 16:89345843-89345865 TAGTGGCTCACCTTACCTCCTGG - Intronic
1143741598 17:8958176-8958198 TAGTGGGTGCCTGTAATCCCAGG + Intronic
1144358316 17:14467199-14467221 TAGTGGGCCCCTGTAATCCCAGG + Intergenic
1145068704 17:19783886-19783908 TAGTGGGGCCCAGCAACTCCGGG - Exonic
1150218610 17:63483680-63483702 GAGTGGGCCACTCTAACTCCAGG - Intergenic
1165527195 19:36366133-36366155 TGGTGGGCGCCTGTAACTCCAGG + Intronic
1168592205 19:57646710-57646732 TATTGGGTCTCTTTTGCTCCTGG + Intergenic
931890165 2:66662366-66662388 TCGTGGCTCCCAATAACTCCTGG - Intergenic
935786463 2:106553184-106553206 TGGTGACTCCCTTTAACACCAGG + Intergenic
936382746 2:112001495-112001517 TTGTGAGTCCTTTTAACCCCAGG - Intronic
936993521 2:118390236-118390258 TAATGGGTCCATCCAACTCCTGG - Intergenic
937896691 2:126981521-126981543 TCTTGGGTCCCTTGAAGTCCTGG + Intergenic
945964026 2:216166252-216166274 TAGTGTGTGCCTGTAGCTCCAGG - Intronic
946562827 2:220931967-220931989 TAGTGACTCCCAATAACTCCAGG + Intergenic
1169277624 20:4244223-4244245 TACTGGGTGCCTTTACTTCCAGG + Intronic
1169965075 20:11208299-11208321 CATTGGTTCCCTTTGACTCCTGG + Intergenic
1172084910 20:32373732-32373754 TGGTGGGTGCCTGTAATTCCAGG + Intronic
1173768007 20:45631460-45631482 TAATGGGTCCTTCTGACTCCAGG - Intergenic
1173773544 20:45684365-45684387 TAATGGGTCCTTCTGACTCCAGG + Intergenic
1176951628 21:15054296-15054318 TGGCGGGTCCCTTTGACTACAGG + Intronic
1182988126 22:34740354-34740376 GAGGGGGTCCCTTTTACTCGAGG - Intergenic
1183092569 22:35532836-35532858 CTGTGGGTCCCTTTAACTGGAGG - Intergenic
1184795055 22:46727503-46727525 TGGTTGGTCTCTCTAACTCCTGG + Intronic
1185054446 22:48571405-48571427 TAGTGGGTGCCTGTAATCCCAGG - Intronic
957352655 3:79046383-79046405 AGCTGGGTGCCTTTAACTCCGGG - Intronic
958523679 3:95224865-95224887 TATTGGGTACCTTTATATCCAGG + Intergenic
960689691 3:120332822-120332844 TCATGGGACCCTTGAACTCCTGG + Intronic
961198887 3:125028155-125028177 TGGGTGGTCCCTTTGACTCCAGG + Intronic
962744862 3:138389689-138389711 TAGTGGGTCCCTTTAACTCCTGG + Intronic
965177238 3:165351109-165351131 TGGTGGGTGCCTGTAATTCCAGG - Intergenic
965683189 3:171273225-171273247 AGGTGGGTCCCTGTAGCTCCAGG - Intronic
972540446 4:40034687-40034709 TGGTGGGTGCCTGTAACCCCAGG + Intergenic
972917582 4:43900148-43900170 TAGTGGGTCCCATTGACTCTTGG - Intergenic
973242641 4:47973198-47973220 TGGTGGGTGCCTTTAATCCCAGG - Intronic
974990358 4:69079386-69079408 GAGCTGGACCCTTTAACTCCTGG - Intronic
977419173 4:96775533-96775555 AAGTGGATCACTTTAACTTCAGG + Intergenic
977541979 4:98329484-98329506 TAATGGGTCCTTTTAAATGCAGG - Intronic
983367973 4:166819792-166819814 AAGTGGCACCCTTGAACTCCTGG + Intronic
985925208 5:3010645-3010667 TTGTCATTCCCTTTAACTCCTGG - Intergenic
993967404 5:94374655-94374677 TAGTGGGTGACTTTAGCTCCAGG + Intronic
994261120 5:97659860-97659882 TAGTGGGTTACTGTAAATCCTGG - Intergenic
996665196 5:126050719-126050741 TAGTGGGTGCCTGTAATCCCAGG - Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002936762 6:1680631-1680653 TTATGGGCCCCTTTAACTCGAGG - Intronic
1010090923 6:71980689-71980711 TAATTGGTCCCTTTTTCTCCAGG - Intronic
1011458654 6:87579876-87579898 TAGTGGGTGCCTGTAATCCCAGG - Intronic
1014817599 6:125952864-125952886 TAGTGGGTAGCCTTCACTCCAGG - Intergenic
1016329827 6:142944957-142944979 CAGTGACTCCCTTTACCTCCCGG - Intronic
1024005623 7:45223458-45223480 CAGTGAGTCCCTTTATCCCCCGG + Intergenic
1024067311 7:45751146-45751168 TAGTGGGTGCCTGTAGTTCCAGG + Intergenic
1031447492 7:121872905-121872927 CAGCGGATCCCTCTAACTCCAGG + Intergenic
1043829413 8:84970079-84970101 TAATGGGTGACTTTAGCTCCAGG - Intergenic
1045594422 8:103636028-103636050 TGGTGGATCCCTTCTACTCCAGG + Intronic
1051513521 9:17906007-17906029 TCGTGGGTCCCCGTCACTCCCGG + Intergenic
1055631408 9:78227968-78227990 TAGTGGCAGCCTTGAACTCCTGG + Intergenic
1058313368 9:103533723-103533745 GAGTGGATTCCTTTAAGTCCAGG + Intergenic
1185685433 X:1924647-1924669 TGGTGGGTGCCTGTAACCCCAGG - Intergenic
1200773926 Y:7152674-7152696 TGGTGGGTGCCTGTAATTCCAGG + Intergenic