ID: 962745038

View in Genome Browser
Species Human (GRCh38)
Location 3:138390643-138390665
Sequence GCCTGTGGCCGGGCATTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962745027_962745038 14 Left 962745027 3:138390606-138390628 CCCCAGGAAGCCCTGGAGTCAGA 0: 1
1: 0
2: 3
3: 51
4: 336
Right 962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
962745030_962745038 4 Left 962745030 3:138390616-138390638 CCCTGGAGTCAGAACTGCTGACA 0: 1
1: 0
2: 2
3: 14
4: 219
Right 962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
962745025_962745038 18 Left 962745025 3:138390602-138390624 CCTCCCCCAGGAAGCCCTGGAGT 0: 1
1: 0
2: 5
3: 52
4: 450
Right 962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
962745031_962745038 3 Left 962745031 3:138390617-138390639 CCTGGAGTCAGAACTGCTGACAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
962745028_962745038 13 Left 962745028 3:138390607-138390629 CCCAGGAAGCCCTGGAGTCAGAA 0: 1
1: 0
2: 4
3: 29
4: 301
Right 962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
962745029_962745038 12 Left 962745029 3:138390608-138390630 CCAGGAAGCCCTGGAGTCAGAAC 0: 1
1: 0
2: 1
3: 31
4: 229
Right 962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143
962745026_962745038 15 Left 962745026 3:138390605-138390627 CCCCCAGGAAGCCCTGGAGTCAG 0: 1
1: 0
2: 2
3: 41
4: 389
Right 962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG 0: 1
1: 0
2: 0
3: 9
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962745038 Original CRISPR GCCTGTGGCCGGGCATTTGC AGG Intronic
900119153 1:1041152-1041174 GCCTGCGGGCGGGGCTTTGCCGG - Exonic
902689850 1:18104103-18104125 GCCTGTGTGTGGGCATTTGTGGG + Intergenic
902932957 1:19744222-19744244 GCCTCTCGCTGGGCACTTGCAGG + Intronic
903221407 1:21871552-21871574 GCCTTTGGCAGAGCATTTGAAGG + Intronic
905279041 1:36837229-36837251 CCCTGTGGCTGGGCACTTGGAGG - Intronic
905773685 1:40654304-40654326 GCCTGGGGCCGAGCCTGTGCTGG - Intronic
907616427 1:55931302-55931324 GTCTGGGGCCTGTCATTTGCAGG + Intergenic
910435386 1:87200786-87200808 GCCTGTGCCAGGGCAGTAGCAGG + Intergenic
916198108 1:162243921-162243943 GCCTGTGGCCTGTCATTTGAGGG + Intronic
919770205 1:201153881-201153903 GGCTGTGGTCGGGTGTTTGCTGG - Exonic
1065814293 10:29470427-29470449 GCCCGTGGAAGGGAATTTGCTGG - Exonic
1074101009 10:110354952-110354974 GCCTTTGGCCTGGCATGTGGAGG - Intergenic
1075425995 10:122342090-122342112 GCCTGTGGCCAGGCCTGAGCTGG - Intergenic
1077028138 11:450748-450770 GACTGTGGCCGGGGGTTTGAGGG + Intronic
1077186051 11:1235910-1235932 GCATGTGGACAGGCATTTTCAGG + Intronic
1077556834 11:3230105-3230127 GCATGGGGCCGGGTATCTGCAGG - Intronic
1081845044 11:46234597-46234619 ACCTGCGGCCTGACATTTGCAGG - Intergenic
1084600243 11:70141224-70141246 GGCTGTGGCCGTTCATTTGGTGG + Intronic
1084925792 11:72510452-72510474 GTCTGAGGCAGGGCATTAGCTGG + Intergenic
1085410701 11:76288742-76288764 GCCTAGGTCCAGGCATTTGCTGG - Intergenic
1085634938 11:78151463-78151485 GCCTGAGGCCAGGCATTTTCAGG + Intergenic
1085657304 11:78328245-78328267 TCCTGTTGCAGGGCATTTACTGG + Intronic
1085702335 11:78756298-78756320 GTCTGTGGCAGGTCCTTTGCTGG - Intronic
1089583385 11:119495393-119495415 GCCAGTGGCCGGGCATGGCCTGG - Intergenic
1090064060 11:123488428-123488450 ACCTGTGGCCTGGCATTAACTGG + Intergenic
1091225252 11:133953272-133953294 GCCTGTGGCCCTGCATGTGCTGG - Intronic
1093568062 12:20632571-20632593 GCCTGTGCCAGGCCATTTGTGGG + Intronic
1094032360 12:26027172-26027194 GCCTATGGCTGGGGATTTGATGG + Intronic
1095945944 12:47753490-47753512 GCCTGAGGTCTGGCATGTGCAGG + Intronic
1101753259 12:107600842-107600864 CCCTGTGGCCTGTCACTTGCAGG - Intronic
1102058547 12:109914942-109914964 GCCTGTGGCCAGGTGTTTGGAGG - Intronic
1102943327 12:116962962-116962984 GCCAGTGGCCGTGCTTTGGCTGG + Intronic
1104930358 12:132336247-132336269 GCCTGAGGCCGCGCAGTTACAGG + Intergenic
1111822371 13:93228439-93228461 GCCAGTGGCCGGGCATGCGGGGG - Intronic
1111924012 13:94443558-94443580 TCCTGAGGCCAGGCATCTGCAGG + Exonic
1119480814 14:74956409-74956431 GCGTGTGCATGGGCATTTGCGGG + Intergenic
1120290705 14:82566717-82566739 GAGTGTGGCCGGGTATTTACTGG - Intergenic
1122294591 14:100698135-100698157 GCATGTGGCCGGGCATTGAGGGG - Intergenic
1124202514 15:27690605-27690627 GGCAGAGGCTGGGCATTTGCTGG - Intergenic
1128248518 15:66149143-66149165 GCCTGTGGCCGTGGTTGTGCAGG - Intronic
1131150155 15:90042750-90042772 GGCTGTGTGTGGGCATTTGCCGG + Intronic
1132339751 15:101070591-101070613 GCCTGGGGCTGGGCTTTTCCAGG - Intronic
1132679333 16:1133324-1133346 GCCTGTGGCCTGGAAGGTGCAGG - Intergenic
1133758334 16:8779066-8779088 GCCTGGGGCTGGGCACTTGGTGG - Intronic
1137601973 16:49762410-49762432 GCCTGTGGCCAGCCCTTCGCAGG + Intronic
1140251143 16:73295375-73295397 GGTAGTGGCTGGGCATTTGCTGG + Intergenic
1141479196 16:84294985-84295007 GCGTGGGGCCGGGCAGCTGCAGG + Exonic
1141763555 16:86044452-86044474 GCCTGGGGACTGCCATTTGCTGG + Intergenic
1144724652 17:17495869-17495891 GCCGGGGGCCGGGCAGGTGCGGG - Intronic
1145239763 17:21233811-21233833 GCCTGTGGCCCTGCATCTCCTGG + Intergenic
1148170395 17:45514750-45514772 ACCTGTGGTAGGGCTTTTGCAGG + Intergenic
1148242847 17:46011752-46011774 GCCTCAGGCCAGGCATTTTCTGG - Intronic
1148278812 17:46331058-46331080 ACCTGTGGTAGGGCTTTTGCAGG - Exonic
1148301025 17:46548920-46548942 ACCTGTGGTAGGGCTTTTGCAGG - Exonic
1148365151 17:47049809-47049831 ACCTGTGGTAGGGCTTTTGCAGG - Intergenic
1148674710 17:49438681-49438703 GCCTGTGGCCAGGCACGGGCGGG - Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150401488 17:64860343-64860365 ACCTGTGGTAGGGCTTTTGCAGG + Exonic
1150759253 17:67945501-67945523 GTCTGTGGCTGGGCTTCTGCTGG - Exonic
1151203993 17:72491547-72491569 GATTGTGGCTGGGCATTTGGTGG - Intergenic
1156341659 18:36215013-36215035 GCCCGGGGCTGGTCATTTGCAGG + Intronic
1157529972 18:48411632-48411654 GCAGGTGTCTGGGCATTTGCAGG - Intergenic
1157570781 18:48710618-48710640 GCCTGTGATCCTGCATTTGCAGG + Intronic
1157790646 18:50528209-50528231 GCCTGTGGCCTGGCTTTTGAAGG + Intergenic
1161055574 19:2189256-2189278 GCCTCTGCCCGGGCAGGTGCAGG - Intronic
1161566210 19:5004306-5004328 GCCTGTGGCAGGGCAAGAGCTGG - Intronic
1164785953 19:30931036-30931058 TCCTGTGGCTGGTCATTTCCTGG + Intergenic
1165130918 19:33631421-33631443 GCCTGGGGCTGGGCCTGTGCTGG + Intronic
926192847 2:10741547-10741569 GACAGTGGCCGGGCACTGGCGGG + Intronic
927467355 2:23347507-23347529 GCCTGTTCCCGGCCATTGGCGGG - Intergenic
927652939 2:24923153-24923175 TCCTGCGGCTGGGCCTTTGCAGG - Intergenic
935965955 2:108476158-108476180 GCCTGTGGCAGGAGAATTGCTGG - Intronic
937062708 2:118992289-118992311 GCCTGTGGCCTGGCATTATGGGG - Intronic
938450951 2:131419561-131419583 GGATGAGGCCGGGCATTTCCTGG - Intergenic
942063232 2:172247421-172247443 GGCTGTGGCCTGGCAATCGCAGG - Intergenic
943727200 2:191264733-191264755 TCTTGTGGTCTGGCATTTGCTGG + Intronic
947837993 2:233189097-233189119 GGCTGTGTCCGGGCAAGTGCAGG - Intronic
1170900033 20:20453607-20453629 GCCTGTGACCTGGCAATTGGAGG - Intronic
1171403150 20:24892345-24892367 GTCTGTTGCAGGGCATCTGCGGG - Intergenic
1172205992 20:33163291-33163313 GCCTGGGGCCTGGCTTTTGGTGG - Intronic
1172323541 20:34016794-34016816 GCCTGGGGCGGGGCATTTTAGGG + Intronic
1173649262 20:44652383-44652405 GCCCGTGGAGGGGCATTTGAGGG - Intergenic
1175582060 20:60107697-60107719 GCCTGTGGCCCAGCTTCTGCTGG - Intergenic
1176228789 20:64019760-64019782 GCCTGAGGCAGGGCCCTTGCTGG + Intronic
1180830703 22:18904574-18904596 GACTCTGGCAGGGCCTTTGCAGG + Intergenic
1181068977 22:20320722-20320744 GACTCTGGCAGGGCCTTTGCAGG - Intergenic
1181458091 22:23070770-23070792 GCCTCTGGTCGGGCAGGTGCTGG + Intronic
1182764201 22:32746767-32746789 GCCCAGGGCCTGGCATTTGCAGG + Intronic
1184218194 22:43081292-43081314 GCCTGTGCCTGGGCTTGTGCTGG - Intronic
1184741481 22:46431219-46431241 GCCTGTGGCCGCCCCTTTCCGGG - Intronic
1184879804 22:47297601-47297623 GCCTGGGGAGGGGCATTTTCCGG + Intergenic
1184918427 22:47589141-47589163 GCCTGTGGATGGCCACTTGCAGG + Intergenic
1185051736 22:48557640-48557662 GCCTGTGGCCTGGCATCTTCAGG - Intronic
1185095432 22:48803728-48803750 GCCTGTGCCTGGACATTTCCCGG - Intronic
1185329687 22:50246622-50246644 GCATGTGGACGGGCATGTGATGG - Intronic
1203280792 22_KI270734v1_random:129845-129867 GACTCTGGCAGGGCCTTTGCAGG + Intergenic
950486387 3:13276435-13276457 GCCTGTGGCCCCGCATTAGGTGG - Intergenic
952884626 3:38004703-38004725 GCCTGCGGCCGAGCATGTGTCGG + Intronic
954408480 3:50358796-50358818 GGTGGTGGCCGGGCGTTTGCTGG - Exonic
954677958 3:52325994-52326016 GCCTGTGGCTGGGCAGTGGCTGG - Intronic
954697833 3:52436934-52436956 GCCTGAGGATGGGCATTGGCCGG - Intronic
954787497 3:53105054-53105076 GCCCATGGCTGGGCATCTGCAGG + Intronic
955342522 3:58136148-58136170 ACCCGTGGCCAGGCACTTGCTGG - Exonic
955802016 3:62696315-62696337 GCCAGTGGCAGGGGGTTTGCAGG - Intronic
956341046 3:68224563-68224585 GCCTGTGGCCTTTCATTTGAGGG + Intronic
957878862 3:86184088-86184110 GTCAGTGGCAGGGCATTTGTAGG - Intergenic
959620355 3:108393213-108393235 GCATGTGGCTGTGCATTTGATGG + Intronic
962246938 3:133803507-133803529 CCCTGTGGCCTGGCTTTTGAGGG + Intronic
962348409 3:134639387-134639409 GGCTGTGACTGGGCATCTGCTGG + Intronic
962745038 3:138390643-138390665 GCCTGTGGCCGGGCATTTGCAGG + Intronic
967070763 3:185960690-185960712 CCCTGTTGCAGGGCATTAGCAGG - Intergenic
976226322 4:82798043-82798065 GCCTGAGGAAGCGCATTTGCCGG - Intronic
985616194 5:923274-923296 GCCAGGGGCTGGGCATTGGCTGG - Intergenic
985788675 5:1913479-1913501 GCCTGTTGCCTGGCATTTTCTGG + Intergenic
997976741 5:138445506-138445528 GCCTCTGTCCGGGAATCTGCCGG - Exonic
1002698721 5:181107720-181107742 GACTTTAGCTGGGCATTTGCGGG + Intergenic
1016473263 6:144397837-144397859 CTCTGTGGCCCAGCATTTGCTGG + Intronic
1017021565 6:150143706-150143728 GCCGGTGCCCGGGGATCTGCGGG + Intronic
1019600783 7:1882707-1882729 GCCTGTGGCAGGGCAGTGGCTGG - Intronic
1022475542 7:30707319-30707341 GCCTGGGACCTGGCATTTTCAGG + Intronic
1023725745 7:43141315-43141337 GCCTGTGTCTGGGCAATTCCTGG - Intronic
1023774949 7:43596765-43596787 GCCTGAGGCAGGGGAATTGCTGG + Intronic
1024238467 7:47415488-47415510 GCCTGTGGCCTGGCTTTGCCTGG - Intronic
1035286023 7:157807737-157807759 GCAGGAGGCCAGGCATTTGCAGG - Intronic
1035375290 7:158403420-158403442 GCCTGTGCCCGGGCCTGTCCAGG - Intronic
1037878640 8:22561884-22561906 GCCTGTGGGCAGGTCTTTGCTGG - Exonic
1037913529 8:22758483-22758505 GCCTGTGGGCTGTCGTTTGCAGG + Intronic
1037957097 8:23068629-23068651 GCCTGCGGCCGGGCATGTCCGGG - Intronic
1037961808 8:23103279-23103301 ACCTGCGGCCGGGCATGTCCGGG + Intronic
1037969730 8:23163664-23163686 GCCTGCGGCCGGGCATGTCTGGG - Intronic
1038586149 8:28790878-28790900 GCCTGAGGCAGGGGATGTGCAGG - Intronic
1040104608 8:43534642-43534664 GCCTGAGGCAGGGCATTGGAAGG + Intergenic
1040861978 8:52008496-52008518 GCCTGGGGCTGTGCAATTGCAGG - Intergenic
1041191872 8:55363218-55363240 GCCTGTGGGACGGCATTTGTTGG - Intronic
1048731171 8:137442291-137442313 GCTTGTGGTGGGGCCTTTGCTGG + Intergenic
1048860282 8:138719809-138719831 GCCTGTGGGCGGGCAGTGGGAGG + Intronic
1049003924 8:139843006-139843028 GCCTGGGGCTGGGCAGTGGCTGG - Intronic
1049612726 8:143562904-143562926 GCCTGTGCCCGGGCATGGCCTGG + Exonic
1053141277 9:35684404-35684426 GCCTGTGGCAGGACACTTGAGGG - Intronic
1057180082 9:93025061-93025083 GTCAGTGTCCGGGCATCTGCTGG + Intronic
1057308169 9:93924613-93924635 GCATCTGGCCAGGCTTTTGCTGG - Intergenic
1059889652 9:118787062-118787084 GCTTGTGGCCGGGCCCTTGAAGG + Intergenic
1061204479 9:129155080-129155102 CCCCGAGGCCGGGCCTTTGCTGG + Intergenic
1062123665 9:134848074-134848096 GCCTGTGGCTGAGCATCTCCTGG - Intergenic
1062457629 9:136646929-136646951 GCCTGTGGCTAGGCCTGTGCAGG - Intergenic
1187169174 X:16834595-16834617 GCCTGAGACGGGGCATTTCCTGG - Intronic
1190297702 X:49038291-49038313 GGCAGTGGCTGGGCACTTGCGGG + Exonic
1192177516 X:68895187-68895209 GCCTGTGGCCAGGCGGGTGCAGG + Intergenic
1192245109 X:69365541-69365563 GACTGTGGCCAGGCACTTCCTGG + Intergenic
1198159799 X:133996503-133996525 GCCTGTGGCAGGTCTCTTGCTGG - Intergenic
1201179476 Y:11332074-11332096 GCCTGTGGCCGGGGGGTTGTGGG - Intergenic
1201863961 Y:18629869-18629891 CCATGTGGCCAGGCATTTGTGGG - Intergenic
1201869361 Y:18690509-18690531 CCATGTGGCCAGGCATTTGTGGG + Intergenic