ID: 962745938

View in Genome Browser
Species Human (GRCh38)
Location 3:138397185-138397207
Sequence GAGCTTATGCAGCCTCTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962745933_962745938 0 Left 962745933 3:138397162-138397184 CCCTTCGAGCAGCCCTAGAGAGA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG 0: 1
1: 0
2: 2
3: 10
4: 133
962745934_962745938 -1 Left 962745934 3:138397163-138397185 CCTTCGAGCAGCCCTAGAGAGAG 0: 1
1: 1
2: 2
3: 13
4: 104
Right 962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG 0: 1
1: 0
2: 2
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962745938 Original CRISPR GAGCTTATGCAGCCTCTCAC GGG Intronic
900290422 1:1921385-1921407 GAGCTTCAGGAGCATCTCACGGG + Intergenic
901710701 1:11112664-11112686 GAGCCTCTGCAGCCTCCCACGGG + Intronic
901877889 1:12177350-12177372 GAGCTTTTGCAGTCGGTCACAGG + Intronic
902460847 1:16575481-16575503 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
902461616 1:16581742-16581764 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
902462397 1:16588047-16588069 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
902527756 1:17070348-17070370 GCGCCTCTGCAGCCTCTCCCTGG + Intronic
903275085 1:22216499-22216521 GAGCTCAGTCAGCCTCTCCCAGG + Intergenic
904161544 1:28525678-28525700 GAGCTTCTGCAGGTTGTCACTGG - Intronic
905325386 1:37148152-37148174 GAGCTCTGGCAGCCTCTGACTGG - Intergenic
905387541 1:37614761-37614783 GAGATCATGCAGCCACTCTCTGG - Intronic
905879016 1:41451460-41451482 GAGCTTATTCAGGGTCACACAGG - Intergenic
906704782 1:47887015-47887037 GGGTTTATCCAGCTTCTCACAGG - Intronic
913064307 1:115236086-115236108 GGGCTCATGCAGCCTCACTCAGG + Intergenic
913543079 1:119840580-119840602 AGGCTTGTGCAGCCTCTCTCTGG + Intergenic
913604577 1:120453098-120453120 AGGCTTGTGCAGCCTCTCTCTGG - Intergenic
913640687 1:120809539-120809561 AGGCTTGTGCAGCCTCTCTCTGG - Intronic
913641448 1:120815811-120815833 AGGCTTGTGCAGCCTCTCTCTGG - Intronic
913990500 1:143607500-143607522 AGGCTTGTGCAGCCTCTCTCTGG + Intergenic
914083965 1:144436105-144436127 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914189986 1:145401383-145401405 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914211839 1:145587085-145587107 AGGCTTGTGCAGCCTCTCTCTGG + Intergenic
914277034 1:146134517-146134539 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914277791 1:146140806-146140828 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914364254 1:146964085-146964107 AGGCTTGTGCAGCCTCTCTCTGG - Intronic
914365023 1:146970375-146970397 AGGCTTGTGCAGCCTCTCTCTGG - Intronic
914365774 1:146976655-146976677 AGGCTTGTGCAGCCTCTCTCTGG - Intronic
914486670 1:148116787-148116809 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914487428 1:148123051-148123073 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914538078 1:148585465-148585487 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914538836 1:148591754-148591776 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914586999 1:149071928-149071950 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914587772 1:149078205-149078227 AGGCTTGTGCAGCCTCTCTCTGG + Intronic
914627844 1:149479868-149479890 AGGCTTGTGCAGCCTCTCTCTGG - Intergenic
917782059 1:178408833-178408855 GAGCCTAGGTAGCCTCACACCGG - Intronic
918464999 1:184812112-184812134 CACCTTATGCACCCTCCCACAGG + Intronic
919525698 1:198647293-198647315 GAGCTCATGTAGGCTATCACTGG + Intronic
922204197 1:223432386-223432408 GAGCTTTAGCAGCCTCTCTCTGG + Intergenic
922850097 1:228725427-228725449 GAGCTTCTGCAGCCTCTCAAAGG + Intergenic
923865001 1:237930328-237930350 GTGCTTATGCAGCCACTTAGAGG - Intergenic
1065861212 10:29873676-29873698 GGGTTTATCCAGCCTCTCAGGGG + Intergenic
1069686295 10:70321231-70321253 GAGCTCCTGCAGCACCTCACTGG - Intronic
1069981318 10:72254935-72254957 GACCTTCTGCAGGCTTTCACTGG + Intergenic
1070784585 10:79155608-79155630 GAGCTCATGCAGCATCGCCCAGG - Intronic
1071049398 10:81428166-81428188 GAGCTTATGGAAGCTTTCACAGG - Intergenic
1074481024 10:113820771-113820793 GACCTGATCCATCCTCTCACAGG - Intergenic
1076495056 10:130891509-130891531 GAGCTTATGCAGCCTGACTGTGG + Intergenic
1088995573 11:114993399-114993421 GAGCTCATGCATCCTCTCTAGGG - Intergenic
1089541353 11:119190790-119190812 GAGCTTGTTCAGCCTCTTCCCGG + Exonic
1089680464 11:120116419-120116441 GACCGCATGCAGCCTCTCACTGG - Intronic
1089832997 11:121345586-121345608 GAGCTTATGCTACCTATCCCTGG - Intergenic
1089861779 11:121596524-121596546 GTGCTTATGCAGCCCCCCACCGG + Intronic
1090114730 11:123956335-123956357 GAGCTTGTGCAGGCCATCACAGG - Intergenic
1090666616 11:128918775-128918797 AAGCTTATGGAGCCCCTCCCTGG - Exonic
1096606694 12:52771804-52771826 GAGCTTATGCTGCTTCTCTCCGG + Intronic
1101901313 12:108792906-108792928 GACCTTGGGCAGCCCCTCACTGG - Intronic
1104885145 12:132102974-132102996 GAGAATATCCAGCCTCCCACAGG - Intronic
1104913761 12:132253275-132253297 GAGAATATCCAGCCTCCCACAGG + Intronic
1105064270 12:133183016-133183038 AAGCTAATGCAGCCTCTGATAGG - Intronic
1106840005 13:33676865-33676887 GAGCATGTGCAGACTCTGACAGG - Intergenic
1108768392 13:53663549-53663571 GAGCTTTGGGAGCCTCTCCCTGG + Intergenic
1108785527 13:53896694-53896716 GAGTTTATTCAGCCTCTCACAGG + Intergenic
1112260064 13:97869598-97869620 GAGGTTATGAATCCTCTCTCAGG - Intergenic
1113614010 13:111668656-111668678 GAGCTGAGGCACCCGCTCACAGG - Intronic
1116040836 14:39684722-39684744 CAGCTTCTGCACCCTCTCTCTGG - Intergenic
1118356258 14:65016426-65016448 GAGCCCATGCTGCCTCTCAGTGG - Intronic
1119785354 14:77309481-77309503 AAGCTACTGCACCCTCTCACAGG + Intronic
1121304049 14:92894405-92894427 GAGTTGGTGCAGCCACTCACAGG + Intergenic
1124925436 15:34066005-34066027 GAGCATCATCAGCCTCTCACAGG + Exonic
1131720459 15:95162849-95162871 TAGTTTATGCAGAATCTCACTGG + Intergenic
1132985689 16:2766128-2766150 GAGCCTCTCCAGCCACTCACCGG + Exonic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1152699428 17:81811776-81811798 GAGCTTCTTCAGCCTCTACCTGG + Exonic
1162650035 19:12081088-12081110 GAGCTAATGCAGACTGTCATGGG + Exonic
1167730513 19:51250915-51250937 AAGCTCATGCAGCCTCTGATTGG + Intronic
1167730519 19:51250979-51251001 AAGCCCATGCAGCCTCTCATTGG + Intronic
1202677276 1_KI270711v1_random:19221-19243 AGGCTTGTGCAGCCTCTCTCTGG + Intergenic
1202678052 1_KI270711v1_random:25489-25511 AGGCTTGTGCAGCCTCTCTCTGG + Intergenic
925947263 2:8877235-8877257 AAGCTTATGCTGCATCTCACTGG - Intronic
926837827 2:17044061-17044083 TAGCTTATGCATCCTTTCCCAGG - Intergenic
927056877 2:19373550-19373572 GAGCCCATGCAGCAGCTCACAGG + Intergenic
929346412 2:40890030-40890052 GAGCTTTTGCAGGCTCCCAGTGG - Intergenic
937364024 2:121248044-121248066 GAGCTTCTGCTCCCTGTCACTGG - Intronic
937884698 2:126891808-126891830 GAGCTGATGCTGGCTCTCGCAGG - Intergenic
940340135 2:152571399-152571421 AAACTGATGCTGCCTCTCACTGG + Intronic
942395760 2:175547782-175547804 CTGCTTATGCAGACCCTCACAGG + Intergenic
942916101 2:181308887-181308909 GAGATTATGCAACCTTTCCCAGG - Intergenic
944536091 2:200711351-200711373 AAGCTGAAGCAGACTCTCACTGG - Intergenic
946158054 2:217819918-217819940 GAGCTTATCCAGCCTGGCCCAGG - Intronic
947731123 2:232432311-232432333 TGGCTTGTGCAGGCTCTCACTGG - Intergenic
948596911 2:239085455-239085477 GAGCTCCTGCAGCGGCTCACGGG + Intronic
1169400067 20:5272119-5272141 GAGCTTCTGCATGCTCACACCGG - Intergenic
1170077599 20:12436826-12436848 GTGCATATGCAACATCTCACAGG + Intergenic
1175138872 20:56844888-56844910 GAGCAAGTGCAGCCTCTGACAGG - Intergenic
1175657749 20:60786796-60786818 GAGCTGAAGCAGCCTATTACAGG - Intergenic
1175753765 20:61516379-61516401 GAGCTCATGCAGCGTCCGACGGG - Intronic
1176298244 21:5085737-5085759 GAGCTCATGCAGCCCCGCACAGG + Intergenic
1176890354 21:14309739-14309761 GAGCTTATTCATCTTGTCACAGG - Intergenic
1178382364 21:32121411-32121433 CAGCTTCTGCAGCCTCACTCTGG + Intergenic
1178435178 21:32551876-32551898 GCTCTTCTCCAGCCTCTCACCGG + Intergenic
1179858784 21:44176212-44176234 GAGCTCATGCAGCCCCGCACAGG - Intergenic
1182420887 22:30248072-30248094 GAGCTCTTGCAGCCTCGCCCGGG + Intergenic
1183189757 22:36314262-36314284 GAGCTGCTGCAGCTTCTCATTGG + Exonic
950719942 3:14875586-14875608 GAGCCTCTGCAGCCACTCAAGGG + Intronic
951806914 3:26655372-26655394 GACATTATGGTGCCTCTCACAGG - Intronic
952688613 3:36177434-36177456 GAGCTGTTGCAGCAGCTCACAGG - Intergenic
952746628 3:36787822-36787844 GAACTGGTGCTGCCTCTCACTGG + Intergenic
952862428 3:37824504-37824526 GAGGTTAGGCATCCTGTCACAGG - Intergenic
954115212 3:48463307-48463329 GATCTTATGAGACCTCTCACAGG - Intronic
962745938 3:138397185-138397207 GAGCTTATGCAGCCTCTCACGGG + Intronic
968549304 4:1214126-1214148 GAGGTTGAGCAGCCCCTCACAGG + Intronic
975863580 4:78703144-78703166 GTGGTTCAGCAGCCTCTCACTGG - Intergenic
989404787 5:41048323-41048345 GAGCTTCTGCAGCCTCTGGAAGG - Exonic
990571376 5:57082432-57082454 GAGCTTGACCAGCTTCTCACAGG - Intergenic
990731484 5:58813739-58813761 GAGCCTATGCAACATCTTACTGG - Intronic
991492549 5:67197034-67197056 GAGCTTCCACAGCCTCTCTCGGG - Intergenic
993096806 5:83488476-83488498 GAGCTTATCCTTCCTCTCAGTGG + Intronic
994214754 5:97125290-97125312 GAACTTCTGCAGGCTATCACAGG - Intronic
1001442251 5:171751844-171751866 GAGCTACTGCAGCATCTCAAGGG + Intergenic
1002538384 5:179890866-179890888 GAGCCAATGCAGCCTCACAGGGG + Intronic
1003366670 6:5481717-5481739 GAGCTTATCCAGCCTTTCCCTGG + Intronic
1005106589 6:22230267-22230289 GGGCTTCTGCGGTCTCTCACAGG - Intergenic
1007510560 6:42371448-42371470 GAGATTAAGCAGCCCCACACAGG + Intronic
1008899066 6:56590723-56590745 GAGTTTATCCAGCCCTTCACTGG - Intronic
1018684151 6:166290230-166290252 GAGCTAATGCAGATTCTCTCAGG - Intergenic
1018928179 6:168221756-168221778 GGGCTTATGCAGACCCTCAAGGG - Intergenic
1026148446 7:67768483-67768505 GAGGTTATGCAGCCTCCTCCAGG + Intergenic
1026763670 7:73145712-73145734 GAGCTTCTGCAGCCTCCCTGTGG - Intergenic
1027040141 7:74955482-74955504 GAGCTTCTGCAGCCTCCCTGTGG - Intergenic
1027083498 7:75246874-75246896 GAGCTTCTGCAGCCTCCCTGTGG + Intergenic
1029391099 7:100274756-100274778 GAGCTTCTGCAGCCTCCCTGTGG + Intergenic
1033209978 7:139453497-139453519 GAGCTTGGGCAGCCTCTTCCTGG - Exonic
1038475487 8:27863527-27863549 GAGCTTGGAAAGCCTCTCACAGG - Intergenic
1040443789 8:47472850-47472872 TATCTAATGCAGCCTCTCAATGG + Intronic
1042632174 8:70830278-70830300 GAGCTTAAGAAGTCACTCACAGG + Intergenic
1047756269 8:127921158-127921180 TGGTTCATGCAGCCTCTCACAGG - Intergenic
1048196843 8:132338388-132338410 GAGCTTATCCAAGCTCACACAGG - Intronic
1049949133 9:627397-627419 GAGCTTCTGCCCCCTCCCACTGG + Intronic
1050378991 9:5005709-5005731 GAGCTTATACAAACTCTCTCAGG - Intronic
1053055345 9:34990288-34990310 GAGCTCCTGTCGCCTCTCACTGG - Intronic
1186070795 X:5817882-5817904 GAGATAATCCAGCTTCTCACTGG - Intergenic
1189581039 X:42406663-42406685 GAGCTGATGCAGCCATTCACAGG + Intergenic
1190033742 X:47000118-47000140 GAGCATAGGCAGCCTCTCTGTGG - Intronic
1199110074 X:143921416-143921438 GAGCTCATACAGATTCTCACAGG + Intergenic
1200002756 X:153070746-153070768 GAGGTCGTGCATCCTCTCACTGG - Intergenic
1200004967 X:153079263-153079285 GAGGTCGTGCATCCTCTCACTGG + Intergenic