ID: 962746644

View in Genome Browser
Species Human (GRCh38)
Location 3:138401992-138402014
Sequence CTGTCCTGGCCGCTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962746644_962746650 -10 Left 962746644 3:138401992-138402014 CCCTCCTCCAGCGGCCAGGACAG 0: 1
1: 0
2: 3
3: 33
4: 327
Right 962746650 3:138402005-138402027 GCCAGGACAGCCACTGGGAGAGG 0: 1
1: 1
2: 4
3: 36
4: 391
962746644_962746652 -9 Left 962746644 3:138401992-138402014 CCCTCCTCCAGCGGCCAGGACAG 0: 1
1: 0
2: 3
3: 33
4: 327
Right 962746652 3:138402006-138402028 CCAGGACAGCCACTGGGAGAGGG 0: 1
1: 0
2: 5
3: 51
4: 423
962746644_962746653 -5 Left 962746644 3:138401992-138402014 CCCTCCTCCAGCGGCCAGGACAG 0: 1
1: 0
2: 3
3: 33
4: 327
Right 962746653 3:138402010-138402032 GACAGCCACTGGGAGAGGGATGG 0: 1
1: 0
2: 2
3: 47
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962746644 Original CRISPR CTGTCCTGGCCGCTGGAGGA GGG (reversed) Intronic
900364724 1:2306435-2306457 GTGTCCTAGCAGGTGGAGGAGGG + Intronic
900675218 1:3881163-3881185 CTGTCCTGGCTCCTTCAGGATGG + Intronic
900916519 1:5643525-5643547 CTGTGGTGGCGGCCGGAGGAGGG - Intergenic
901089770 1:6633465-6633487 CTGTCCAGGCTGATGGAGGAGGG - Exonic
901404743 1:9038576-9038598 CTGCCCTGGTGGGTGGAGGATGG + Intronic
901415066 1:9110927-9110949 CTCTCCTGCCCCCTGGTGGACGG - Intronic
901786176 1:11626286-11626308 CTGTCCTGCAGGCTGGAGGTGGG - Intergenic
902261394 1:15227365-15227387 CTGTCCTAGGCGTTGTAGGAGGG - Intergenic
902540977 1:17154504-17154526 CTGACTTGGAGGCTGGAGGAAGG - Intergenic
902548932 1:17208004-17208026 CTGGGCTGGCAGCAGGAGGAAGG + Intronic
902776017 1:18675521-18675543 CTGTCCTGGGCTCTGGAGGTGGG + Intronic
903281486 1:22252508-22252530 CTGGGCTGGGGGCTGGAGGAGGG + Intergenic
903382741 1:22908275-22908297 CTGTCCTGGGCCCTGGAGACAGG + Intronic
903973871 1:27136831-27136853 CTCTCCTGGCTGATGGAGAAGGG - Intronic
904591995 1:31620110-31620132 CTTTCCTGGCCAGTGCAGGAGGG - Intronic
904608190 1:31710218-31710240 CTGTCCTGGGCACTGTAGGATGG - Intergenic
904621252 1:31776663-31776685 CTATCAGGGCCACTGGAGGATGG + Intergenic
904778415 1:32926026-32926048 CATTCCAGGACGCTGGAGGACGG - Intergenic
904814110 1:33182179-33182201 CTTCCCTGGGAGCTGGAGGATGG - Intergenic
904868642 1:33602462-33602484 CAGTCCTGGGAGCTGGAGTACGG + Exonic
904891167 1:33780688-33780710 CTGTTCTAGCCCCTGGAGGCTGG - Intronic
905279503 1:36840044-36840066 CTGTCCTGGCCCCTGGGGTCAGG + Intronic
905554817 1:38873597-38873619 CTGTCCTGGCGTCCGGAGGCAGG + Exonic
905871009 1:41404628-41404650 CTGTGCTGGGAGCTGGGGGAGGG + Intergenic
906659676 1:47573457-47573479 GTGTGCTGGCCGCAGGAAGAGGG + Intergenic
906819835 1:48918052-48918074 CAGGCCTGGCTGCTGGAGAAAGG - Intronic
907242180 1:53086925-53086947 CTGTCCTGGTGGCTGCAGTAAGG - Intergenic
909806965 1:79884079-79884101 CTGTTCTGGAATCTGGAGGATGG + Intergenic
910397415 1:86806470-86806492 CTCTCTTAGCCGCTCGAGGAAGG + Intergenic
911943311 1:104073916-104073938 CCGTCCAGGCTGATGGAGGAGGG - Intergenic
912372761 1:109186562-109186584 CTCTCTTGGCTGCTGGAGAAGGG - Intronic
912423742 1:109567232-109567254 CTGTCCAGACCTCTGGAAGAGGG + Intronic
912637760 1:111314557-111314579 CTCTCCTGGCCATTGGAGGCTGG + Exonic
913285825 1:117225423-117225445 CTGGCCTGGGGCCTGGAGGAAGG + Intergenic
915543470 1:156582960-156582982 CTGTCTTGGTTGCTGGAGGGTGG + Intronic
915951063 1:160190326-160190348 GTGCCCTGGACACTGGAGGAGGG + Intergenic
916120949 1:161527374-161527396 GAGTCCTGGACTCTGGAGGATGG + Intergenic
916130427 1:161607116-161607138 GTGGCCTGGGTGCTGGAGGACGG - Intronic
916130722 1:161609012-161609034 GAGTCCTGGACTCTGGAGGATGG + Intronic
918800205 1:188961241-188961263 CTGTTCTGGGGCCTGGAGGATGG - Intergenic
920295036 1:204950830-204950852 CTGTGCCAGCCACTGGAGGATGG - Intronic
920348391 1:205321552-205321574 CTAGCCCGGCCGCTGGCGGAAGG - Exonic
920400371 1:205672339-205672361 CAGACCTGCCTGCTGGAGGAAGG + Intronic
921724403 1:218507940-218507962 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
922723042 1:227908538-227908560 CTGTCGTGGCTGGTGGAGCAGGG - Intergenic
1063995022 10:11611312-11611334 CATTCCCGGCCCCTGGAGGAGGG - Intronic
1065024497 10:21527204-21527226 CGGGCCGGGCAGCTGGAGGAAGG + Intergenic
1065510237 10:26471173-26471195 CTGTCCTTGCCTCTGGACAAGGG + Intronic
1067435391 10:46273080-46273102 CTGCCCTGGCCAGTGAAGGAGGG - Intergenic
1067582185 10:47452769-47452791 CCGCCCTGGCCGGTGGGGGAGGG - Intergenic
1067669012 10:48302928-48302950 CAGTTCTTGCAGCTGGAGGATGG + Intergenic
1069137301 10:64782131-64782153 CTCTCGTAGCCGCTCGAGGAAGG + Intergenic
1069863028 10:71483065-71483087 CCGTCCTGGCGGATGGAGGCAGG + Intronic
1072009318 10:91289804-91289826 CCCTCCTGGCCACTGGAAGAGGG + Intergenic
1072790043 10:98311319-98311341 CTGTCCTGAACCCTGGAGGGAGG - Intergenic
1072805932 10:98424072-98424094 CTGTCCTGGGTGCAGGAGCAGGG - Intronic
1073544697 10:104338268-104338290 CGGTCCCCGCCGCGGGAGGACGG + Intronic
1074261497 10:111858042-111858064 CTGTTCTGGGGGCAGGAGGAGGG - Intergenic
1074506473 10:114075370-114075392 CTGTCCTGGGCATTGTAGGATGG - Intergenic
1076157622 10:128215863-128215885 CTTTCCTGGCCGTGGGTGGAGGG + Intergenic
1076720363 10:132389710-132389732 CTCTCCTGGCCACTGGAGGAGGG + Intergenic
1076754130 10:132559148-132559170 GTGTGCTCGCCTCTGGAGGAAGG + Intronic
1076992189 11:281259-281281 CTGTCCTACCTGCTGGAGGACGG + Exonic
1077114876 11:879606-879628 CAGTCCTGGGGGCTGGAGGTGGG - Intronic
1077170836 11:1165082-1165104 CTGTCCTGGCCCCCTGAGGCTGG + Intronic
1077184638 11:1230702-1230724 CTGGCCTGGGGGCTGGAGGGGGG - Intronic
1077267606 11:1659761-1659783 CTGCCGCGGCGGCTGGAGGATGG + Intergenic
1077416387 11:2426167-2426189 CTGTCCCGTCCTCGGGAGGAAGG - Intergenic
1079500221 11:21094410-21094432 CTGTTCTGGGGTCTGGAGGATGG + Intronic
1079961355 11:26927965-26927987 ATGTCAGGGCTGCTGGAGGATGG + Intergenic
1079992987 11:27266233-27266255 CTGGCCTGGCCCCAGGAGGACGG + Intergenic
1081224489 11:40503223-40503245 CTGTCCTGGGGTCTGTAGGAAGG - Intronic
1081421466 11:42877648-42877670 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1083311544 11:61786378-61786400 CTGTCCTGGCCCCTAGGGGGTGG - Exonic
1083893825 11:65610515-65610537 CTGGTCTGGCTGCTGGAGGCGGG + Intronic
1084172365 11:67406701-67406723 CTGACATGGGGGCTGGAGGAAGG + Intronic
1084211051 11:67622710-67622732 CTCTCATAGCCGCTCGAGGAAGG - Intergenic
1084457635 11:69277747-69277769 CTGTGCTGGTCTCTGGAGGTGGG - Intergenic
1085640198 11:78188598-78188620 CTGCGCTGGCCGCTCGCGGAGGG - Exonic
1088561575 11:111120856-111120878 CTGTCCTTGGAGCTGGAGGGTGG - Intergenic
1089576994 11:119451901-119451923 CTGTCCTGCCCTCTGGGGGATGG + Intergenic
1089581788 11:119485938-119485960 CTGTCCTCGCTGCTGGTAGAGGG + Intergenic
1090207687 11:124895035-124895057 ATGTCCTGGCAGCAGTAGGAAGG + Intronic
1090390149 11:126382909-126382931 CTGGCGGGGCAGCTGGAGGAAGG + Intronic
1091539720 12:1448826-1448848 CTGTTCTGGGGTCTGGAGGATGG - Intronic
1092120249 12:6038567-6038589 GTGTTCTGTCCGCTGGAGGAGGG - Intronic
1092126944 12:6081086-6081108 CTTTCCTGAACGCAGGAGGATGG - Intronic
1092377910 12:7970827-7970849 ACGTCCCGGCCGCTGCAGGAAGG + Intergenic
1096195934 12:49648833-49648855 CAGGCCTGGCGCCTGGAGGAAGG + Intronic
1096304663 12:50463760-50463782 CTGTTCTGGAGTCTGGAGGACGG + Intronic
1096551278 12:52373819-52373841 CTGTCCTGGCCACTGAACTAAGG - Intergenic
1096757730 12:53814110-53814132 CTGCCTTGGCCCCTGGTGGATGG + Intergenic
1097146387 12:56942282-56942304 CTTTCCCTGCCACTGGAGGAGGG + Intergenic
1098866896 12:75773331-75773353 CAGTCTGGGCCACTGGAGGATGG + Intergenic
1100297653 12:93277632-93277654 CTGTCTTGTCCACTGCAGGAAGG + Intergenic
1100891494 12:99131171-99131193 CTGTCCTGGCCCCTGGATGTTGG - Intronic
1101772886 12:107767690-107767712 CTGCCCCATCCGCTGGAGGAAGG - Intergenic
1102576771 12:113860683-113860705 CTTTCCTGACCCCTGGAGGCTGG + Intronic
1102699105 12:114823769-114823791 CTGGCCTGGGCCCTGGAGTAGGG - Intergenic
1102924452 12:116816086-116816108 CTGTCCTGGTCCCAGGTGGATGG - Intronic
1103013930 12:117479478-117479500 CTGTCCTGGGCATTGCAGGATGG + Intronic
1103040714 12:117693180-117693202 CAGTCTTGGCTGCTTGAGGATGG - Intronic
1103562514 12:121800069-121800091 CCGCCCGGGCCGCTGGGGGAGGG - Intronic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1104770620 12:131361228-131361250 CTGTCATGGGCTGTGGAGGACGG + Intergenic
1104863968 12:131941813-131941835 CTGGACTGGGCGCAGGAGGAAGG + Exonic
1104903136 12:132199761-132199783 CTGTTCTGGAGGCTGGAGGTTGG - Intronic
1104945976 12:132415047-132415069 CCGTCCTGGTGGCTGGAGGACGG + Intergenic
1105059374 12:133134399-133134421 CTGGCCTTGCAGGTGGAGGAAGG + Intronic
1105240133 13:18600648-18600670 CTGTCCACGCTGCTGGAGGCGGG + Intergenic
1106434340 13:29710538-29710560 CTGTCCTGGGAGCTGGATGTTGG + Intergenic
1112954539 13:105041938-105041960 CTGTTCTGGTTTCTGGAGGATGG + Intergenic
1114548957 14:23522463-23522485 CTGGGGTGGCGGCTGGAGGAGGG + Exonic
1114866013 14:26597188-26597210 GTGTCCGGGCCGCGGGAGGGAGG + Intronic
1115219543 14:31045925-31045947 CTTTCCTGGAGGCTGGAGGGTGG - Intronic
1115443455 14:33462519-33462541 GTGTCCTGGGCCCTGGAGGAAGG + Intronic
1115491777 14:33965003-33965025 CTTTCCTGGAAGCTGGAGGGTGG + Intronic
1116039096 14:39664001-39664023 TTGTTCTGGCAGCAGGAGGAAGG + Intergenic
1116666568 14:47783555-47783577 CTGTCCTGGCTGCTAGAGCTGGG + Intergenic
1118524577 14:66624529-66624551 CTGTCCTTGGAGCTGGAGGGTGG - Intronic
1118736394 14:68704529-68704551 CTGTCCTGGCCATTGTAGGATGG + Intronic
1119700902 14:76753903-76753925 CTGTCCTGTGCACTGTAGGACGG - Intergenic
1120528152 14:85601476-85601498 CTGTCCTAGCAGCTGGTGAATGG + Intronic
1120704932 14:87735966-87735988 TTGCCCTGCCAGCTGGAGGAGGG + Intergenic
1120813712 14:88831179-88831201 CTGTCATGGCAGCTGGTGGGAGG - Intronic
1121636353 14:95456455-95456477 CTGTCCTGTGCACTGTAGGATGG + Intronic
1121884295 14:97528861-97528883 CTGTCCTGTGCACTGTAGGATGG + Intergenic
1122201043 14:100122866-100122888 CTGCCCTGGACCCTGAAGGAGGG - Intronic
1122399254 14:101457749-101457771 CTGGCCTGGGCCCAGGAGGATGG + Intergenic
1123061794 14:105597829-105597851 CTGGCCGGGCCCCTGGAGGTGGG + Intergenic
1123086532 14:105719560-105719582 CTGGCCGGGCCCCTGGAGGTGGG + Intergenic
1124251230 15:28107486-28107508 CTGCCCGGGCTGTTGGAGGAGGG - Intergenic
1128026079 15:64437811-64437833 TTGTCCTGGCAGCTGTAGGAAGG + Intronic
1128572259 15:68742374-68742396 CTGTGCAAGCTGCTGGAGGAAGG - Intergenic
1128747671 15:70125866-70125888 CAGTGCTGGCCACTGGAGGTTGG + Intergenic
1130228149 15:82075728-82075750 GTGTGCTGGCCCCTGGAGAAGGG + Intergenic
1131018993 15:89082025-89082047 CTGTCCTGGGCACTGGAGGGTGG + Intergenic
1132071666 15:98783054-98783076 CTGCCTAGGCTGCTGGAGGATGG + Intronic
1132111494 15:99105203-99105225 CTGTCCTGGCGGCTGCAGACGGG + Exonic
1132287231 15:100672156-100672178 CTGTCCTGCCCTCTGCCGGATGG - Intergenic
1133286700 16:4694032-4694054 CGCTTCTGGTCGCTGGAGGACGG + Exonic
1133601204 16:7341978-7342000 CTGTATTGGCTCCTGGAGGAGGG + Intronic
1134249369 16:12563623-12563645 CTGTCCTGGCCCCAGAAGGTAGG + Intronic
1136063135 16:27740566-27740588 CTGTCCTTGCCGGTGGGAGAAGG - Exonic
1136288645 16:29258713-29258735 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1136552749 16:30990227-30990249 CTGTCCAGGCGGCCGGAAGAGGG + Exonic
1137817020 16:51408046-51408068 CTGTCCAGGCTGCTCCAGGAGGG - Intergenic
1138578878 16:57926642-57926664 CTGTGCTGGGCACAGGAGGATGG - Intronic
1141244627 16:82294356-82294378 CAGTCCTGGCCACTGCAGGAAGG + Intergenic
1141288493 16:82695067-82695089 AAGTCCTGTCGGCTGGAGGAAGG + Intronic
1141299727 16:82802782-82802804 CTTTCCTGGCAGCTTGAAGAGGG - Intronic
1142094360 16:88231619-88231641 CTGGCCTGGAAGGTGGAGGAAGG - Intergenic
1142196134 16:88740105-88740127 GGGTGCTGGCCGCTAGAGGAGGG - Intronic
1142220890 16:88854433-88854455 CTGTCCTGGCAGCTGCACCATGG + Intronic
1143074840 17:4332734-4332756 CTGACCTGAACGCTGGAGGGAGG - Intronic
1143782486 17:9236594-9236616 CTGTCCTGGCCGCAGGGGCAGGG - Intronic
1144850187 17:18240321-18240343 CTGTTCGGGCCTCTGCAGGAGGG + Intronic
1146911284 17:36649939-36649961 CTGACCTGGGGGCTGGGGGAGGG + Intergenic
1147575318 17:41595598-41595620 CTGTCCAGTCTGATGGAGGAGGG + Intergenic
1147787913 17:42993107-42993129 TTGTCCTGGAGGCTGGATGATGG + Exonic
1147874328 17:43610303-43610325 CTGTGCAAGCTGCTGGAGGACGG - Intergenic
1148106434 17:45121264-45121286 CTGTACCGGCTGCAGGAGGACGG - Exonic
1148392752 17:47284702-47284724 CTGTCCTGGCGTCTGGAGGAGGG - Intronic
1149588541 17:57810545-57810567 CTGTCCTGGGGGCTGGAAGTGGG - Intergenic
1150223963 17:63512810-63512832 CCGTCCTGGTCTCTGGGGGAGGG - Intronic
1151326687 17:73384000-73384022 CTCTGCTGGCGGCTGCAGGAAGG + Exonic
1152110259 17:78353769-78353791 CTGGCCTGGCTGGGGGAGGAGGG - Intergenic
1152286014 17:79413777-79413799 CTGGCCAGGCCGCAGAAGGATGG - Intronic
1152376215 17:79920137-79920159 CTCCCCTGCCCGCTGCAGGAGGG - Intergenic
1152460325 17:80438984-80439006 CTGCCCTTGGCCCTGGAGGACGG - Intergenic
1152656420 17:81521489-81521511 TAGTCCTGGCTGCTGGGGGATGG - Intronic
1152687916 17:81703672-81703694 CCGGCCTGGCCGCTGCAGGGAGG - Intronic
1152822791 17:82445705-82445727 GTGTCCTGCCCGCTGGAAGCAGG - Intronic
1152858044 17:82677458-82677480 TTGAGCTGGCCGCTGCAGGATGG - Intronic
1152865974 17:82723285-82723307 CTGTCCTGTCCTCGAGAGGAGGG + Intronic
1152920677 17:83065038-83065060 CTGTCCGGGCCTCCGGGGGAGGG - Intergenic
1153325224 18:3811731-3811753 CGGTCCAGGACGTTGGAGGAGGG + Intronic
1153336666 18:3932221-3932243 TTGTCCTGGCAGCTTGAGGTTGG + Intronic
1153440875 18:5117770-5117792 CTGTTCTGGGATCTGGAGGATGG - Intergenic
1155540411 18:26863483-26863505 GCATCCTGGCCGCTGGAGGTGGG + Intronic
1156389162 18:36634614-36634636 CAGCCCTGGCTCCTGGAGGAAGG + Intronic
1157604140 18:48915093-48915115 GTGTCCTGGCCTCAGGAGGAGGG - Intergenic
1158020561 18:52836756-52836778 CTGTCATGGGGTCTGGAGGATGG + Intronic
1158103085 18:53853032-53853054 CTATCCTGGCAGCTGGGGGATGG - Intergenic
1159225061 18:65523101-65523123 CTGTCTTGGCTGCTGCAGCAGGG - Intergenic
1160586309 18:79915328-79915350 CTGGCCTGGCCCCGGGGGGATGG - Intronic
1161398976 19:4059281-4059303 CTTTCCTGGGGCCTGGAGGATGG + Intronic
1162035276 19:7935000-7935022 GTCCCCTGGCCGCTGGAGGCTGG - Intronic
1162561845 19:11421825-11421847 CTACCCTGGCCGCAGGAGGACGG - Exonic
1162705764 19:12553806-12553828 CTGTCCTGTACGCTGGGGAAAGG + Intronic
1163263704 19:16206050-16206072 CTGTCCCGGCGGCTGGGTGAAGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1166094523 19:40530671-40530693 CCGTCGTGGCCGCGGGAGGGAGG + Intronic
1166112402 19:40630670-40630692 CAGTCCTGACAGCTGGAGGCGGG + Intergenic
1167672213 19:50859762-50859784 CAGTCCTGGCCGGTGGGGAAGGG - Intronic
1167756091 19:51414819-51414841 CTAACCTGGCAGCTGCAGGATGG + Exonic
1168408189 19:56121367-56121389 CTGTCCTCGCCGCTCTAGGAAGG + Intergenic
925257064 2:2499372-2499394 CTGTTCTGGGGTCTGGAGGATGG + Intergenic
925868404 2:8248386-8248408 CTGTGCTGTCCTATGGAGGAAGG - Intergenic
926062632 2:9813735-9813757 CTGGCCAGGCCTTTGGAGGAAGG - Intergenic
926238035 2:11063527-11063549 CTGTCATGGAGGCAGGAGGAGGG + Intergenic
926787359 2:16531319-16531341 CTGTCCTGCCTGCTGGTGAAAGG + Intergenic
927403475 2:22741400-22741422 CTGATCTGGCTGCTGGAGGTAGG - Intergenic
928938664 2:36705871-36705893 CTGTCCTGGGCATTGCAGGATGG + Intronic
930812951 2:55561452-55561474 CTGTTCTGGGGTCTGGAGGATGG - Intronic
932793517 2:74675509-74675531 CTTTCCTGTCCCCTAGAGGATGG + Exonic
933397852 2:81754650-81754672 CTGTTCTGGGTTCTGGAGGACGG + Intergenic
933727240 2:85433865-85433887 CTGTCCTGGCCGCAGCAGCTGGG - Intronic
934113049 2:88759924-88759946 CTGTTCTGGGGTCTGGAGGACGG - Intergenic
934900812 2:98158619-98158641 GTGTCCTGGCAGCAAGAGGATGG + Intronic
935184397 2:100718470-100718492 CTGCCCTGCACCCTGGAGGAAGG - Intergenic
935584720 2:104790375-104790397 CTCTCCTGGGGGCAGGAGGAGGG - Intergenic
938143768 2:128817416-128817438 TTGTCCTGGCCCCTGGAGGCTGG + Intergenic
938314089 2:130314631-130314653 CTCCCCTGGTGGCTGGAGGAGGG + Intergenic
938323633 2:130382486-130382508 CTGTGCTGGCTGCTTGAGCATGG + Intergenic
940430845 2:153588216-153588238 CTGTTCTGGAGTCTGGAGGATGG + Intergenic
942155025 2:173119431-173119453 CCATCATGGCCACTGGAGGAAGG + Intronic
943079979 2:183247474-183247496 CTGAGCTGGCCCCTGAAGGATGG - Intergenic
944729035 2:202499581-202499603 CTCTCGTAGCCGCTCGAGGAAGG - Intronic
946496904 2:220204126-220204148 CTGCCCAGGAAGCTGGAGGAGGG + Intergenic
946656620 2:221955391-221955413 ATGTCTTGGCCGGTGGAGCATGG + Intergenic
947316691 2:228866484-228866506 CAGTCCTGCCAGCTGGAGGGGGG + Intronic
947523782 2:230866388-230866410 ATGACCTGGACCCTGGAGGAGGG + Intronic
948044950 2:234936422-234936444 CTCTCCTGGCCTTTGGAGGCTGG + Intergenic
948592392 2:239059823-239059845 CTGTCCTGCAGGCTGGTGGATGG - Intronic
1171139786 20:22730593-22730615 CTGTTCTGGCTGCAGGATGATGG + Intergenic
1171308409 20:24125821-24125843 ACCTCCTGGCAGCTGGAGGATGG - Intergenic
1171370690 20:24660483-24660505 CAGGCCTGGCCTCAGGAGGAAGG + Intronic
1171487072 20:25493048-25493070 CTGTCCTGGAACCTGGTGGAGGG - Intronic
1172340681 20:34155098-34155120 CTCTCATAGCCGCTTGAGGAAGG - Intergenic
1174706213 20:52658823-52658845 CTGTCCTGGACATTGCAGGATGG - Intergenic
1175388104 20:58610212-58610234 CTGTCCTGGGCTCCAGAGGAGGG + Intergenic
1176002075 20:62836701-62836723 CTGTCCTCTGCGCTAGAGGATGG + Intronic
1176082838 20:63282514-63282536 CTGTCCTGAAGTCTGGAGGATGG + Intronic
1179015684 21:37592829-37592851 CTGCCCTGGGTGCTGGAGGAGGG - Intergenic
1179514917 21:41899693-41899715 CTGTCGTGGACTCTGAAGGACGG - Intronic
1179727101 21:43346771-43346793 CTGGCCTGGCTGCTTGGGGAGGG + Intergenic
1181044441 22:20207868-20207890 CTGCCCTGGCCCCTGGGGCATGG - Intergenic
1181631862 22:24155862-24155884 CTGGACTGGCCGCTGGTGGCGGG - Intronic
1181752235 22:24996838-24996860 CTGTCATAGCAGCTGGGGGATGG + Intronic
1182260458 22:29070393-29070415 CTGTCCTGCCTGCTGCGGGAAGG - Intergenic
1182886777 22:33780455-33780477 CACTCCAGGCAGCTGGAGGATGG + Intronic
1183101813 22:35588799-35588821 TTCTCCTGGCCCTTGGAGGAAGG - Intergenic
1184092738 22:42300946-42300968 CTGTCCTGGCCTCTGAAGGTGGG - Intronic
950121712 3:10486067-10486089 CTGACCTGGCCACTGGCTGAGGG - Intronic
952453057 3:33449312-33449334 CTCTCGTAGCCGCTTGAGGAAGG - Intergenic
952983749 3:38759288-38759310 CTGCTTTGGCCACTGGAGGAAGG - Intronic
952990727 3:38828866-38828888 CTGTTCTGGGCTATGGAGGAAGG + Intergenic
953389637 3:42526847-42526869 CTGGCCTTTCCGGTGGAGGAGGG - Intronic
953543026 3:43839587-43839609 CTGTCCTGACTGCTGCTGGAAGG + Intergenic
954322976 3:49844482-49844504 CTGACTTGGATGCTGGAGGAAGG - Intronic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
954973954 3:54675483-54675505 CTCTCCTGGCCCCTGGGGAAAGG + Intronic
955016894 3:55079214-55079236 CTGTCCTGGGCTTTGTAGGATGG - Intergenic
955407160 3:58632837-58632859 CTGCCGTGGCCCCTGGTGGAAGG + Intergenic
958601413 3:96300453-96300475 CTCTCGTAGCCGCTCGAGGAAGG - Intergenic
961429643 3:126872194-126872216 CTGTCCTGGGCACTGTAGGGTGG - Intronic
961491209 3:127257863-127257885 CTGCCCTGACAGCTGGAGGCTGG - Intergenic
962279563 3:134039690-134039712 CTGTCCTGGTCGCTCCAGCAGGG - Intronic
962746644 3:138401992-138402014 CTGTCCTGGCCGCTGGAGGAGGG - Intronic
963671645 3:148258706-148258728 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
963932735 3:151020986-151021008 CTGTCCTTGCTCCTGGTGGATGG - Intergenic
964258292 3:154804787-154804809 CTATTCTGGGGGCTGGAGGATGG + Intergenic
968728623 4:2259647-2259669 GGGCCCTGGCTGCTGGAGGAGGG - Intronic
968753431 4:2402100-2402122 CTCTCCCTGGCGCTGGAGGAGGG + Intronic
968947538 4:3673333-3673355 CTGTCTTGGGTGCTGAAGGACGG + Intergenic
969457328 4:7307500-7307522 CTGCCCTGGCCGCTTGGGGGTGG + Intronic
970361290 4:15311085-15311107 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
971172555 4:24248571-24248593 GTGTCATGGTCGCTGGGGGAGGG - Intergenic
971281181 4:25243706-25243728 CTCTCGTAGCCGCTCGAGGAAGG + Intronic
976787637 4:88839823-88839845 TTGTCCTGGGGGGTGGAGGATGG + Intronic
977545090 4:98367488-98367510 CCGTCCTGGGGTCTGGAGGATGG - Intronic
979551218 4:121993093-121993115 CTGTCCTGGCATCAGGAGGAGGG + Intergenic
980503059 4:133682058-133682080 TTCTCCTGGCAGATGGAGGATGG - Intergenic
983923484 4:173371378-173371400 CTGTGCTGCCTGCGGGAGGATGG + Exonic
985016653 4:185643206-185643228 CTGTGCTGGGACCTGGAGGATGG + Intronic
985629075 5:1005465-1005487 CTGTCCTTGTCCCTGGGGGACGG - Intergenic
985665257 5:1178781-1178803 CCTGCCTGGGCGCTGGAGGAGGG + Intergenic
988707279 5:33738706-33738728 CTGTCCTGGCTGAGGAAGGACGG + Intronic
988738288 5:34044598-34044620 CTGTTCTGGTAGCTGCAGGAGGG - Intronic
988814952 5:34825655-34825677 CTGGCCGTGCTGCTGGAGGAAGG + Intronic
990043361 5:51398904-51398926 CTGCCCTGCCCGCTGGACGTGGG - Intergenic
993804274 5:92384829-92384851 CTGGCTTGGAAGCTGGAGGAAGG - Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
995527156 5:113059269-113059291 CTGTCCTGGAAGCAGGAGAAGGG - Intronic
999186217 5:149711626-149711648 CTGTGCTGGCCTGGGGAGGATGG + Intergenic
1002409176 5:179060612-179060634 CAGTCCAGGCCGCTCGCGGACGG - Exonic
1004277711 6:14253229-14253251 CTGTCCTGGCCTCTGCAGAGAGG + Intergenic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006465398 6:34191007-34191029 CTATCCTGGCGGCGGGGGGAGGG - Intergenic
1006581887 6:35082127-35082149 CTGTCCAGGGCACTGGTGGAAGG - Intronic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1007688082 6:43679253-43679275 CTGTCCTGTGCAGTGGAGGATGG - Intronic
1007950157 6:45864873-45864895 CTGTCCTGGCCACTTGCTGATGG + Intergenic
1009289454 6:61866046-61866068 CTATTCTGGGCTCTGGAGGATGG + Intronic
1009552605 6:65118489-65118511 CTGTTTTGACCTCTGGAGGAAGG + Intronic
1010179840 6:73073401-73073423 CTGTCCTGGGCATTGTAGGATGG + Intronic
1010928558 6:81772954-81772976 CTGTCCAGGCCTCTGCAGCAGGG + Intergenic
1011167599 6:84466808-84466830 CTGACCTGGCCACTGCAGCATGG + Intergenic
1011942252 6:92857248-92857270 CTATCCTGGGGTCTGGAGGATGG + Intergenic
1012276119 6:97277589-97277611 TTGTCCTGGTCACTGGAAGAGGG - Intronic
1013366896 6:109443658-109443680 GTGTCCTGGCGGCTGGAGGAGGG + Exonic
1013607600 6:111764905-111764927 CTTTGCTGGCAGCTGGAGGCAGG + Intronic
1014143578 6:117971431-117971453 CAGTTCTGGCATCTGGAGGATGG + Intronic
1016840437 6:148519690-148519712 GTGTCCAGGCTGCTGGAGGATGG - Exonic
1018726468 6:166616654-166616676 CTGGCCTGGCAGAGGGAGGATGG - Intronic
1018915917 6:168132251-168132273 GTCACCTGGCTGCTGGAGGAGGG + Intergenic
1019293210 7:260515-260537 CTGGCCTGTGCGCTGGTGGACGG + Exonic
1019294935 7:269063-269085 CCTTCCTGGCTGCTGGAGGACGG + Intergenic
1019345059 7:525610-525632 CCCTCCTGGCCTCTGGAGGAGGG + Intergenic
1019730729 7:2627945-2627967 CCTTCCTGGCAGCTGGAGGGAGG + Intergenic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020257312 7:6509302-6509324 GGGTCCTGGGCCCTGGAGGAGGG + Exonic
1026095538 7:67343548-67343570 CTGTCCTGGGTGCAGGATGAAGG + Intergenic
1027226575 7:76247544-76247566 CTGCCCTGGTGGGTGGAGGAGGG + Intronic
1028025199 7:85828580-85828602 CTGTGCTGGCCGATTGAGGATGG - Intergenic
1028178159 7:87681676-87681698 ATGTGCTGGCTGCTGAAGGATGG + Intronic
1030826850 7:114169181-114169203 CTGTTCTGGGGGCTGGAGGACGG - Intronic
1032080495 7:128856251-128856273 CTGTCCTGGCTGAGGAAGGAAGG - Intronic
1032326165 7:130930418-130930440 CTGTCAGTGCTGCTGGAGGAAGG - Intergenic
1033759242 7:144422244-144422266 CTCTCATAGCCGCTCGAGGAAGG + Intergenic
1034270840 7:149802842-149802864 CTGCCCAGGCCGGGGGAGGAGGG + Intergenic
1034286880 7:149890634-149890656 ATGTTCTGGACCCTGGAGGAGGG - Intergenic
1034989385 7:155538515-155538537 CTGTCCTGGGCACGTGAGGAGGG - Intergenic
1036494564 8:9258518-9258540 CAGTCCTGGAAGCTGGAGGGAGG + Intergenic
1038219677 8:25595385-25595407 CTGGCCAGGCTGCTGGAGAAGGG - Intergenic
1038730397 8:30121756-30121778 ATGTCCTGGCCTCTGGATTAGGG + Intronic
1042837284 8:73090407-73090429 CTGACCTGGCAGCTGGAAGCTGG - Intronic
1042982078 8:74540864-74540886 CTGTTCTGGGGTCTGGAGGATGG + Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1044775261 8:95680075-95680097 CTGTCCTGGCTGCTGTATGTGGG + Intergenic
1045494848 8:102699668-102699690 GTGTCCTTGCCGAAGGAGGAAGG + Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1048305259 8:133279624-133279646 CTGTGCTGGCCTCTGGAGGGTGG - Intronic
1050472370 9:6007383-6007405 CTGTCCGGGCTGCTGCGGGAAGG + Exonic
1054720195 9:68596146-68596168 CTGTCCTGGCCAATGGAGATGGG + Intergenic
1055641043 9:78319345-78319367 CTGGGCTTGCAGCTGGAGGAGGG - Intronic
1056874850 9:90318415-90318437 CCTTACTGGCTGCTGGAGGATGG + Intergenic
1057482679 9:95457912-95457934 ATGTCTGGGCCTCTGGAGGAGGG - Intronic
1057566054 9:96167069-96167091 CTGTTCTTGCCGCTGGAGTCTGG + Intergenic
1061026465 9:128052942-128052964 CTGTCCTGTTCACTGTAGGATGG - Intergenic
1061677521 9:132226778-132226800 CTGGCCTGGCCTCTGGGGAAAGG - Intronic
1061968778 9:134032019-134032041 CTGGCCAGGCCACTGGAGGCTGG + Exonic
1062519970 9:136953689-136953711 CAGTGCTGGCCTCTGTAGGAGGG - Exonic
1062525140 9:136975180-136975202 CAGTCCTAGCCGGGGGAGGAGGG + Intergenic
1062606126 9:137349637-137349659 CTGTGGGGGCCGCTGGTGGAGGG - Intronic
1185614911 X:1414884-1414906 CAGGCCTGGCCGCTGTCGGATGG + Intronic
1185816867 X:3164239-3164261 ATGTCCTGGCTGCAGGAGGAAGG - Intergenic
1186624509 X:11278404-11278426 CTGGCCTTGAAGCTGGAGGAAGG + Intronic
1187033101 X:15508860-15508882 CTGTCCTGTGCACTGCAGGATGG - Intronic
1189612828 X:42754991-42755013 CATTCCTGGCAACTGGAGGAAGG + Intergenic
1190395281 X:49976021-49976043 CTGTCCTGTGCACTGTAGGATGG - Intronic
1190427332 X:50345610-50345632 CTGTCCTGGCCAACAGAGGAAGG - Intronic
1192870011 X:75176071-75176093 CTCTCGTAGCCGCTCGAGGAAGG + Intergenic
1193066419 X:77265072-77265094 CTGTTCTGGGGTCTGGAGGATGG - Intergenic
1195232357 X:102862490-102862512 CTGTGCTGGGATCTGGAGGAGGG - Intergenic
1196419381 X:115506944-115506966 CTCCCATGGCCGCTCGAGGAAGG + Intergenic
1196735426 X:118977305-118977327 CTTTCCTGGCCCCTGGGGGATGG - Intronic
1199858551 X:151779606-151779628 CTGGCCTGTCCACAGGAGGAAGG - Intergenic
1201264515 Y:12193169-12193191 ATGTCCTGGCTGCAGGAGGAAGG + Intergenic
1201496397 Y:14594718-14594740 CTCTCGTAGCCGCTCGAGGAAGG + Intronic
1201555734 Y:15263400-15263422 CTCTCATAGCCGCTTGAGGAAGG - Intergenic