ID: 962748030

View in Genome Browser
Species Human (GRCh38)
Location 3:138412003-138412025
Sequence TCCCCAGCAAAACTCAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962748030_962748037 -7 Left 962748030 3:138412003-138412025 CCATTCCTGAGTTTTGCTGGGGA No data
Right 962748037 3:138412019-138412041 CTGGGGACTTGGGGGTCACAGGG No data
962748030_962748038 -3 Left 962748030 3:138412003-138412025 CCATTCCTGAGTTTTGCTGGGGA No data
Right 962748038 3:138412023-138412045 GGACTTGGGGGTCACAGGGATGG No data
962748030_962748040 14 Left 962748030 3:138412003-138412025 CCATTCCTGAGTTTTGCTGGGGA No data
Right 962748040 3:138412040-138412062 GGATGGTCCCTCTGCTGTCAGGG No data
962748030_962748043 26 Left 962748030 3:138412003-138412025 CCATTCCTGAGTTTTGCTGGGGA No data
Right 962748043 3:138412052-138412074 TGCTGTCAGGGCCTCTCAGTTGG No data
962748030_962748039 13 Left 962748030 3:138412003-138412025 CCATTCCTGAGTTTTGCTGGGGA No data
Right 962748039 3:138412039-138412061 GGGATGGTCCCTCTGCTGTCAGG No data
962748030_962748036 -8 Left 962748030 3:138412003-138412025 CCATTCCTGAGTTTTGCTGGGGA No data
Right 962748036 3:138412018-138412040 GCTGGGGACTTGGGGGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962748030 Original CRISPR TCCCCAGCAAAACTCAGGAA TGG (reversed) Intergenic
No off target data available for this crispr