ID: 962748752

View in Genome Browser
Species Human (GRCh38)
Location 3:138417429-138417451
Sequence GAATTGGAATAACTTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962748752_962748758 9 Left 962748752 3:138417429-138417451 CCTTGGGCAAGTTATTCCAATTC No data
Right 962748758 3:138417461-138417483 GGGTTCCCTCTTCTGAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962748752 Original CRISPR GAATTGGAATAACTTGCCCA AGG (reversed) Intergenic
No off target data available for this crispr