ID: 962750678

View in Genome Browser
Species Human (GRCh38)
Location 3:138432933-138432955
Sequence GATCCTGTCTCCAAGGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962750678 Original CRISPR GATCCTGTCTCCAAGGGGTT TGG Intergenic
901460866 1:9390844-9390866 GAACCTGTGCCCAAGGTGTTTGG - Intergenic
901663452 1:10813260-10813282 GACTCTGTCTCAAAGGGGTGAGG - Intergenic
903451928 1:23459521-23459543 GATTCTCTCTCCAAGGACTTTGG + Intronic
905254446 1:36671174-36671196 GATCCTGTCTCCAAGGTTTTTGG + Intergenic
905359827 1:37411507-37411529 AATTCTGTCTTTAAGGGGTTTGG + Intergenic
906781949 1:48580448-48580470 GCTCATGTGACCAAGGGGTTAGG - Intronic
907747340 1:57226404-57226426 GAGAATGTCTCCAAGGGCTTGGG - Intronic
908319052 1:62963370-62963392 GATCCTGCCTCCTAGTGGTCAGG - Intergenic
908786596 1:67740658-67740680 AATACTGTCACCATGGGGTTAGG - Intronic
908817945 1:68052724-68052746 GAACATGTGTCCAAGGTGTTTGG - Intergenic
911259127 1:95665913-95665935 GCTTCTGTCTCCATGGAGTTGGG + Intergenic
920416400 1:205801541-205801563 GTTTCTATCTCCAAGGGCTTTGG + Intronic
922171994 1:223163291-223163313 GATCCTGCATGCAAGGGATTTGG + Intergenic
922601381 1:226857378-226857400 GCTTCTGTCTCCATGGAGTTGGG - Intergenic
923557186 1:235010298-235010320 GATCTTCTCTCCAAGGGCTCCGG - Intergenic
1064097435 10:12434378-12434400 GATTCTGTGTACAAGGGGTCTGG + Intronic
1066341730 10:34540771-34540793 GATCCTGTCTCGGAGGGGACCGG + Intronic
1067168704 10:43886111-43886133 CATCCTGTCTGCAAGGAGCTGGG - Intergenic
1069931052 10:71881871-71881893 GATCCTGCCCCCAAGTGGCTGGG + Intergenic
1071815562 10:89229303-89229325 GATCCTGGTTGCCAGGGGTTAGG + Intronic
1075633485 10:124015423-124015445 GGTCCTGGCTCCAAGGGTATTGG - Intronic
1076802016 10:132835236-132835258 GGTCCTGGCTCCCAGGGGTGGGG + Intronic
1077032598 11:476233-476255 GGTCTTGCCTCCAAGGGGTTTGG + Intronic
1077487809 11:2847106-2847128 GATGCTTTCTGCAAGGGGGTGGG - Intronic
1078058046 11:8023305-8023327 GCTCCTGCCTCCAAGAGGTAAGG - Intronic
1078720129 11:13876638-13876660 GATCCTGTCTCCAGGCTCTTAGG + Intergenic
1079589496 11:22165012-22165034 CATCCTTTCTCCAAGGAGTCAGG + Intergenic
1080399681 11:31922324-31922346 GGTGCTGACTCCCAGGGGTTGGG + Intronic
1081530697 11:43957167-43957189 GAACATGTCTCCAAGGTGGTTGG + Intergenic
1082802334 11:57424380-57424402 ACCCCTTTCTCCAAGGGGTTGGG - Intronic
1088232450 11:107686945-107686967 GACCCTGTCTCAAAGGAGGTGGG - Intergenic
1093781457 12:23142056-23142078 AATCCTGTCTTCAAGGGGGATGG + Intergenic
1094080901 12:26534082-26534104 GCTGGTGTCTCCACGGGGTTAGG - Intronic
1094314896 12:29128889-29128911 GCTCCTGTCTCCATGCAGTTGGG - Intergenic
1094325352 12:29232023-29232045 GAACATATCTCAAAGGGGTTGGG + Intronic
1099448056 12:82775439-82775461 GACCCTGTCTCCAGGGGGGCGGG + Intronic
1100969410 12:100051803-100051825 GATCCTCTCTCCAAAGTGCTGGG - Intronic
1101319838 12:103663857-103663879 GATCCTAAATCCCAGGGGTTGGG - Intronic
1103950800 12:124549996-124550018 GATCCTGTATCGCAGGGGTCTGG + Intronic
1107404422 13:40099240-40099262 TAACCTGTCTCCAAGTGGCTTGG - Intergenic
1108200245 13:48036253-48036275 GATCCTGTCTCCAAATGCTGAGG + Intergenic
1109110276 13:58309013-58309035 GAGCCAGTCTCCCAAGGGTTTGG - Intergenic
1112809934 13:103206460-103206482 GATCAGGTCTCCAAGGTTTTCGG - Intergenic
1114499776 14:23160090-23160112 GATCCAGTCTCCAAGAGAATGGG + Intronic
1118113148 14:62745604-62745626 CATCATGTCTGTAAGGGGTTGGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122235152 14:100327173-100327195 GATCCTGTCTGCTAGGTGTGGGG + Exonic
1122864210 14:104596256-104596278 GTTCCTGTCTTCCAGGGTTTTGG + Intronic
1123106007 14:105841358-105841380 GACCCTGTCTCCAGGGGCTGGGG + Intergenic
1128562809 15:68679684-68679706 GACCCTGACTTCTAGGGGTTCGG + Intronic
1129035108 15:72644386-72644408 CATCTTGGCGCCAAGGGGTTGGG + Intergenic
1129207110 15:74043928-74043950 GGACCTGTATCCATGGGGTTTGG + Intronic
1129208809 15:74053632-74053654 GTTCCTTTCTCCAGGGGGGTTGG - Intergenic
1129214774 15:74092830-74092852 CATCTTGGCGCCAAGGGGTTGGG - Intergenic
1132564529 16:615444-615466 GACACTTTCTCCAAGGGGCTTGG - Intronic
1133581357 16:7147407-7147429 GATCCTGTCACCCAGGTGGTGGG + Intronic
1135813259 16:25608960-25608982 GATCCTTTCTCCCAGGAATTTGG - Intergenic
1140884288 16:79229250-79229272 AAACCCGTTTCCAAGGGGTTGGG - Intergenic
1142759012 17:2032504-2032526 GATCCAGACACCAAGGGGGTTGG - Intronic
1146529543 17:33596624-33596646 AATCTTGTCTCCTGGGGGTTGGG - Intronic
1147705215 17:42421483-42421505 GATCCCGCCTCCCTGGGGTTAGG + Intronic
1148136142 17:45293145-45293167 CATCCTGTCTCCAAAGGTTATGG - Intronic
1151575420 17:74950580-74950602 GACCCTGTCACCTAGGGTTTGGG - Intergenic
1151721394 17:75858288-75858310 GCTCCTGTCTCCAACGTATTTGG - Intergenic
1152637340 17:81435533-81435555 GCTCCCGTCTCAAAGGGGTCTGG + Intronic
1153535539 18:6098057-6098079 AATCTGGTATCCAAGGGGTTTGG - Intronic
1156311165 18:35923369-35923391 GAACATGTCTCCAAGGTGGTCGG + Intergenic
1160475461 18:79181432-79181454 GGTCATGTCTCAGAGGGGTTTGG - Intronic
1161397545 19:4052531-4052553 GTTCCTGTCCCCACGGGGTGGGG + Intronic
1161700869 19:5794381-5794403 CCTCCTGTCTCCAAAGGGCTAGG - Intergenic
1163690800 19:18737181-18737203 GGTCCTGTCAGCAAGGGGTGGGG + Intronic
1163697953 19:18773476-18773498 GATCCTGTCCCTGAGGGCTTGGG - Intronic
1167103568 19:47418489-47418511 GAGCCTGTCTCCCTGGGGATGGG - Intronic
1167368871 19:49068997-49069019 GATTCTGTATCCATGGGATTGGG - Exonic
1168359213 19:55724426-55724448 GTTCCTGTCCCCATGGGGCTCGG - Intronic
925055269 2:852382-852404 GATCCTGTGCTCAAGGTGTTCGG + Intergenic
925754244 2:7118761-7118783 GGTCCTGTCACCATGGGGTGCGG - Intergenic
926318713 2:11732558-11732580 GATAATGTCTGCAAAGGGTTTGG + Intronic
927474314 2:23400823-23400845 GATCTTGTCTCTAAGTGGTATGG + Intronic
928594476 2:32846852-32846874 TAACCAGTCTCCAAGGGGGTAGG + Intergenic
928710288 2:33997485-33997507 GAGCCTGTATCCATGGGGATTGG + Intergenic
937695764 2:124806798-124806820 GATCCTGTCTGTAAAGGGCTTGG + Intronic
939850058 2:147293274-147293296 AATCATGTCTCCAAGGGGCCTGG - Intergenic
941387683 2:164873287-164873309 GATCGTGTGACCAAGGGCTTTGG - Intergenic
942925412 2:181426247-181426269 GATCCTGTCAGGAAAGGGTTGGG - Intergenic
943365183 2:186961930-186961952 GATTCTGTCTCGAAAGGGGTGGG - Intergenic
945512119 2:210715375-210715397 GCTTCTTCCTCCAAGGGGTTGGG + Intergenic
946023745 2:216659467-216659489 TGCCGTGTCTCCAAGGGGTTGGG + Intronic
947139817 2:227010459-227010481 GATCCTGGGCCCAAAGGGTTTGG - Exonic
947681714 2:232039852-232039874 GATCATGTCCCCAAATGGTTAGG + Intronic
947774975 2:232701357-232701379 GACCCTGTCTCCTGGGGGTTTGG + Intronic
948769039 2:240238566-240238588 GACTCTGTAACCAAGGGGTTCGG - Intergenic
1170125313 20:12956735-12956757 GCTCCTGTCCCCATGGAGTTGGG + Intergenic
1172448838 20:35007693-35007715 GTTCAGTTCTCCAAGGGGTTGGG + Intronic
1175620077 20:60436126-60436148 CCTCCTGTCTGCAAGGGGCTGGG + Intergenic
1178419531 21:32432515-32432537 CATTCTGTCTAGAAGGGGTTTGG + Intronic
1178501672 21:33130831-33130853 GACCATTTCTCCAAGGAGTTTGG + Intergenic
1179448341 21:41449737-41449759 GCTTCTGTCCCCACGGGGTTGGG + Intronic
1182352219 22:29705370-29705392 GATCCTGTGTGCGTGGGGTTGGG + Intergenic
949555818 3:5151722-5151744 GATCCTATCTCCAAGGGGGGGGG - Intronic
952217827 3:31295271-31295293 GATCCAGGCTCCAAGGGCTCTGG + Intergenic
952491343 3:33876556-33876578 GATCCTGGCTCCAGTGGCTTCGG + Intergenic
953829158 3:46280603-46280625 GACCCTGTCTCAAAGGGGCGGGG - Intergenic
954696345 3:52429256-52429278 GATGCTGTCTCCCTGGGGTCAGG - Intergenic
960610042 3:119547332-119547354 TCTCCTTTCTCCAAGGGGGTGGG + Intronic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
969489810 4:7492676-7492698 CAGCCAGTCTCCAAGGGGCTGGG - Intronic
973267034 4:48221168-48221190 GCTTCTGTCTCCATGGAGTTTGG + Intronic
977316135 4:95450218-95450240 GATCCCATCTTCAAGGGGGTTGG - Intronic
979958233 4:126982006-126982028 GCTTCTGTCTCCATGGAGTTGGG + Intergenic
982234989 4:153243819-153243841 GATCCTGTCTCAAGGGGGGGGGG - Intronic
982734480 4:158991274-158991296 GATTCTGTCTCCAAGGTCTTTGG - Intronic
985402490 4:189606500-189606522 GATCCTGTCTTCAAAGCGTGGGG + Intergenic
985591157 5:766234-766256 GCTCCTGTCTCCCAGTGGGTAGG - Intronic
989172480 5:38486421-38486443 GATCCTTTTTCTAAGTGGTTTGG - Intronic
991330015 5:65483974-65483996 GATTCTGTCTCCAAGTTGATTGG + Intergenic
992613422 5:78527236-78527258 TTTCCTGTCTCCAAGGCGTTTGG - Intronic
999051526 5:148528997-148529019 GTTCCTGTCTCAAAAGTGTTAGG - Intronic
1000833706 5:166131806-166131828 GAGCCTCCCTCCAAGGGGATTGG - Intergenic
1002060837 5:176625034-176625056 GACCCTGCCTCCATGGGGATGGG - Intronic
1002945442 6:1756895-1756917 GATCCTGTCGCCAATGCGTGCGG - Intronic
1003828099 6:9974840-9974862 GCTTCTGTCTCCATGGAGTTTGG + Intronic
1006669484 6:35720738-35720760 GATCGTGGCTCCAAGGAGCTGGG - Intronic
1016541282 6:145168671-145168693 GATTATGTTTCCAAGGTGTTAGG - Intergenic
1016601477 6:145866483-145866505 GATTCTCTTTCCAAGGTGTTAGG - Intronic
1016893615 6:149032045-149032067 GAGCCTGGCTCCAAGAGGCTGGG - Intronic
1018780507 6:167059720-167059742 GTTCCTGTCTTCATGGAGTTGGG + Intergenic
1020252756 7:6483349-6483371 GATCCTGGACCCAAGGGCTTGGG + Intronic
1022452225 7:30525839-30525861 GCTCATGTCTCCAAGGACTTTGG - Intronic
1022898490 7:34777295-34777317 AATGCTGTCTCCATGGGGTGGGG + Intronic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1028640068 7:93031898-93031920 GATTCTGTCACCATGGTGTTAGG - Intergenic
1029241386 7:99165738-99165760 GACTCTGTCTCAAAGGGATTGGG - Intergenic
1030552706 7:110984031-110984053 GATTCTCTCTCAAAGGGATTTGG + Intronic
1032470497 7:132175004-132175026 GCTCATGTCTCCTAGGGGCTTGG - Intronic
1035613408 8:984446-984468 GGCCCTGTTTCTAAGGGGTTGGG + Intergenic
1037302067 8:17462393-17462415 TATCCTGGCTCCAGGGGCTTAGG + Intergenic
1038554048 8:28494310-28494332 GCGCCTGGCTCCAAGGGGTGGGG - Exonic
1039469611 8:37805079-37805101 GATGCTATCTCCTAGGTGTTGGG + Intronic
1047244866 8:123132925-123132947 CCTCCTGTTTCAAAGGGGTTTGG - Intronic
1049119812 8:140725356-140725378 GTTCCTGTCTGCAAGAGGGTTGG - Intronic
1050418230 9:5436466-5436488 GCTCCTGTTTGTAAGGGGTTAGG + Intronic
1053486381 9:38459953-38459975 GACCCTGTCTCAAAAGGGTCTGG + Intergenic
1058180278 9:101790126-101790148 GATCCTGTCACACAGTGGTTTGG + Intergenic
1061010034 9:127949449-127949471 CATCCTGTCTGCAAGGTCTTGGG - Intronic
1061252765 9:129436386-129436408 GATCCTCGCTCTGAGGGGTTTGG - Intergenic
1061420371 9:130470255-130470277 GATCCCGTCTCCAAGGCACTCGG - Intronic
1186399526 X:9244454-9244476 AATCCTGTCTCAAAGGGGAAAGG + Intergenic
1186550718 X:10502423-10502445 TATCCTGTCTCCAACACGTTGGG - Intronic
1187258084 X:17659367-17659389 TTTCCTGTCTCAAAGGGATTTGG + Intronic
1188904345 X:35774300-35774322 GATCCTATATCCAAAGGATTTGG + Intergenic
1196692619 X:118576556-118576578 GTACCTGTCTCCAAGGGCTGTGG + Intronic
1197440674 X:126485385-126485407 TACCCTGTCTCCAAGGCTTTGGG + Intergenic