ID: 962752466

View in Genome Browser
Species Human (GRCh38)
Location 3:138443912-138443934
Sequence GGGTCCACACAGATGGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 381}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962752466_962752470 -9 Left 962752466 3:138443912-138443934 CCCAGACCCATCTGTGTGGACCC 0: 1
1: 0
2: 1
3: 27
4: 381
Right 962752470 3:138443926-138443948 TGTGGACCCCACCAAAACCTTGG 0: 1
1: 0
2: 0
3: 11
4: 129
962752466_962752474 0 Left 962752466 3:138443912-138443934 CCCAGACCCATCTGTGTGGACCC 0: 1
1: 0
2: 1
3: 27
4: 381
Right 962752474 3:138443935-138443957 CACCAAAACCTTGGCTCCGATGG 0: 1
1: 0
2: 0
3: 3
4: 60
962752466_962752480 19 Left 962752466 3:138443912-138443934 CCCAGACCCATCTGTGTGGACCC 0: 1
1: 0
2: 1
3: 27
4: 381
Right 962752480 3:138443954-138443976 ATGGGAGGCAGCTGTCATTCTGG 0: 1
1: 0
2: 3
3: 32
4: 211
962752466_962752477 4 Left 962752466 3:138443912-138443934 CCCAGACCCATCTGTGTGGACCC 0: 1
1: 0
2: 1
3: 27
4: 381
Right 962752477 3:138443939-138443961 AAAACCTTGGCTCCGATGGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
962752466_962752475 1 Left 962752466 3:138443912-138443934 CCCAGACCCATCTGTGTGGACCC 0: 1
1: 0
2: 1
3: 27
4: 381
Right 962752475 3:138443936-138443958 ACCAAAACCTTGGCTCCGATGGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962752466 Original CRISPR GGGTCCACACAGATGGGTCT GGG (reversed) Intronic
900663541 1:3798487-3798509 GGGTCCACTCAGATGGTTGGGGG - Intergenic
900718568 1:4160519-4160541 GGGTCCACACAGAAGCCTCTGGG + Intergenic
900847501 1:5115457-5115479 GGTCCCACACAGATGGGACGCGG - Intergenic
902727522 1:18347025-18347047 GGGGCCAGACAGATGGGTTTGGG + Intronic
903180432 1:21602430-21602452 GGGTGGCCACAGATGGGCCTGGG - Intronic
903668144 1:25020630-25020652 AGCCCCACTCAGATGGGTCTGGG + Intergenic
904041378 1:27586988-27587010 GGGTCCTCAGAGATGGATTTTGG - Intronic
905060496 1:35135706-35135728 GGTCCCACACAGATGGGACGTGG + Intergenic
906632028 1:47379489-47379511 GGGTCCATTCAGATGGTTGTGGG + Intergenic
907292654 1:53426631-53426653 GGTCCCACACAGATGGGACGCGG - Intergenic
907521282 1:55024935-55024957 GGTCCCACACAGATGGGACGCGG - Intergenic
907564313 1:55420626-55420648 GGGGCCTAACAGATAGGTCTAGG - Intergenic
908031843 1:60008899-60008921 GTCACCACACAGATGGTTCTAGG - Intronic
908591932 1:65645251-65645273 GGTCCCACACAGATGGGACGCGG + Intergenic
908852428 1:68388600-68388622 GGTCCCACACAGATGGGACGCGG - Intergenic
909014728 1:70369730-70369752 GGTCCCACACAGATGGGACATGG - Intronic
909374512 1:74924328-74924350 GGGTCCTCCCAGCTGGGTCCTGG + Intergenic
909909983 1:81247774-81247796 GGTCCCACACAGATGGGACGTGG - Intergenic
909978429 1:82070891-82070913 GGTCCCACACAGATGGGACGTGG + Intergenic
910275928 1:85449180-85449202 GGGCCCCCACAGAAGGGGCTAGG + Intronic
911570416 1:99511954-99511976 GGTCCCACACAGATGGGACGTGG - Intergenic
913329995 1:117659285-117659307 GGGTCTACACAAGTGGGTCTAGG - Intergenic
915874021 1:159593163-159593185 GGGTTCACACAGCTGTGCCTGGG + Intergenic
919968206 1:202550609-202550631 AGGTTCACACAGATGTGTATGGG - Intronic
920456005 1:206101612-206101634 GGGTCCAAATAGCTGTGTCTGGG - Intronic
921212443 1:212911840-212911862 GGTCCCACACAGATGGGACGCGG - Intergenic
921459756 1:215413319-215413341 GGTCCCACACAGATGGGACGCGG + Intergenic
921497374 1:215857967-215857989 GGATCCACTCAGATGGTTGTTGG + Intronic
921520154 1:216147882-216147904 GGTCCCACACAGATGGGACGCGG - Intronic
922346472 1:224700698-224700720 GGGCCCAAACAGAAGGGACTGGG + Intronic
922755813 1:228096439-228096461 GTGTCCTCACAGAGGCGTCTGGG + Intronic
922906418 1:229176754-229176776 GGTCCCACACAGATGGGACGCGG - Intergenic
922934847 1:229414719-229414741 GGTCCCACACAGATGGGACATGG - Intergenic
923244779 1:232120513-232120535 GGTCCCACACAGATGGGACGCGG - Intergenic
1063018596 10:2103076-2103098 GGGTCCACTCAGATGGTTAGGGG + Intergenic
1063106386 10:2996357-2996379 GGTCCCACACAGATGGGACATGG + Intergenic
1065168961 10:23009308-23009330 GGGACCACACATCTGGGTGTGGG - Intronic
1065443095 10:25772116-25772138 GGTCCCACACAGATGGGACGCGG + Intergenic
1068058326 10:52037141-52037163 GGTCCCACACAGATGGGACACGG + Intronic
1068179636 10:53502412-53502434 GGTCCCACACAGATGGGACACGG + Intergenic
1068230996 10:54169090-54169112 GGTCCCACACAGATGGGACGCGG - Intronic
1068360794 10:55973535-55973557 GGTCCCACACAGATGGGACATGG - Intergenic
1068718904 10:60220313-60220335 GGGTCCATTCAGATGGTTCGGGG - Intronic
1070722098 10:78764065-78764087 TTATCCACACAGATGGGGCTGGG - Intergenic
1071916226 10:90297340-90297362 GGTCCCACACAGATGGGACGCGG - Intergenic
1074248110 10:111714460-111714482 GGGGCCACTGTGATGGGTCTGGG - Intergenic
1074848058 10:117416252-117416274 GGAAGCACACAGATGGGCCTAGG + Intergenic
1075211689 10:120496451-120496473 GGGTCCTCACAGGTGGCTCTGGG + Intronic
1077507998 11:2941042-2941064 GGGTCCAAACAGCTGGGCCTGGG + Intergenic
1077589859 11:3483011-3483033 GGTCCCACACAGATGGGACATGG + Intergenic
1080027893 11:27632461-27632483 GGTCCCACACAGATGGGACACGG + Intergenic
1081356830 11:42122910-42122932 GGTCCCACACAGATGGGACGCGG - Intergenic
1082631229 11:55544600-55544622 GGATCCATGCAGTTGGGTCTGGG - Intergenic
1084396348 11:68913313-68913335 GCGTGCACACAGGTGTGTCTTGG - Intronic
1084451644 11:69242604-69242626 GGGTCCACACAGAGGCCTCTGGG + Intergenic
1084827112 11:71739793-71739815 GGTCCCACACAGATGGGACATGG - Intergenic
1087839517 11:102907456-102907478 GGTCCCACACAGATGGGACGCGG + Intergenic
1089458593 11:118639879-118639901 GAGTCCTCAGAGATGGGGCTGGG + Intronic
1089559503 11:119336708-119336730 GGGCCCACCCAGATGCCTCTGGG + Exonic
1089604707 11:119635203-119635225 TGGCCCACACAGAGGGGCCTTGG + Intronic
1089867024 11:121641301-121641323 GGTCCCACACAGATGGGACACGG + Intergenic
1090112008 11:123922215-123922237 GGGTCTGTACAGATGGCTCTGGG + Intergenic
1090873115 11:130765449-130765471 GGGTCAGCAGAGATGGCTCTAGG - Intergenic
1092723698 12:11465547-11465569 GGTCCCACACAGATGGGACGCGG + Intronic
1093071141 12:14708251-14708273 GGTCCCACACAGATGGGACGCGG + Intergenic
1093267986 12:17025081-17025103 GGTCCCACACAGATGGGACATGG + Intergenic
1093302253 12:17471884-17471906 GGTCCCACACAGATGGGACACGG - Intergenic
1093321963 12:17723652-17723674 GGTCCCACACAGATGGGACGTGG + Intergenic
1093578838 12:20765711-20765733 GGTCCCACACAGATGGGACATGG - Intergenic
1093584496 12:20820379-20820401 GGTCCCACACAGATGGGACACGG + Intronic
1094316028 12:29138379-29138401 GGTCCCACACAGATGGGTCATGG + Intergenic
1094400701 12:30058312-30058334 GGTCCCACACAGATGGGACATGG - Intergenic
1095637676 12:44452131-44452153 GGTCCCACACAGATGGGACATGG - Intergenic
1095778161 12:46032193-46032215 GGTCCCACACAGATGGGACACGG - Intergenic
1097417031 12:59326596-59326618 GGTCCCACACAGATGGGACGTGG + Intergenic
1097542177 12:60955360-60955382 GGTCCCACACAGATGGGACGTGG + Intergenic
1098402274 12:70087735-70087757 GGTCCCACACAGATGGGACGCGG - Intergenic
1099188739 12:79542194-79542216 GGTCCCACACAGATGGGACACGG - Intergenic
1099292080 12:80786455-80786477 GGTCCCACACAGATGGGACGCGG + Intergenic
1099762609 12:86941134-86941156 GGTCCCACACAGATGGGACGCGG - Intergenic
1100940321 12:99717522-99717544 GGTCCCACACAGATGGGACGCGG - Intronic
1101077428 12:101145812-101145834 GGTCCCACACAGATGGGACATGG - Intergenic
1101278375 12:103226057-103226079 GGTCCCACACAGATGGGACGTGG + Intergenic
1101785874 12:107883135-107883157 GGGTTCACCCAGAGGGGTGTTGG - Intergenic
1101903982 12:108811953-108811975 AGGTCCACAGAGCTGGCTCTTGG - Intronic
1102688553 12:114742610-114742632 GGACCCACACAGATGGGGCAGGG + Intergenic
1103927626 12:124432667-124432689 GGGTCCTCACAGCTGGTCCTTGG - Intronic
1103957763 12:124587818-124587840 TGGGCCACACAGGTGGGTCCTGG - Intergenic
1105450491 13:20494955-20494977 GGGACCACACAGCAGGGTCCTGG - Intronic
1106541771 13:30696933-30696955 AGTCCCACACAGATGGGCCTGGG + Intergenic
1107075602 13:36318777-36318799 GGTCCCACACAGATGGGACGGGG - Intronic
1108282044 13:48870500-48870522 GGTGCCACACAGATGGGACATGG + Intergenic
1108513017 13:51172202-51172224 GGTCCCACACAGATGGGACGCGG - Intergenic
1108814147 13:54269191-54269213 GGTGCCACACAGATGGGACGCGG - Intergenic
1108913397 13:55581622-55581644 GGTCCCACACAGATGGGACGCGG + Intergenic
1108919523 13:55658351-55658373 GGTCCCACACAGATGGGACACGG + Intergenic
1108947457 13:56042646-56042668 GGTCCCACACAGATGGGACGTGG - Intergenic
1109716719 13:66229758-66229780 GGTCCCACACAGATGGGACGTGG + Intergenic
1110511973 13:76361423-76361445 GGGCACACACAGCTGGGTCAAGG + Intergenic
1110845366 13:80186007-80186029 GGTCCCACACAGATGGGACATGG - Intergenic
1111302070 13:86360741-86360763 GGTCCCACACAGATGGGACGCGG - Intergenic
1111458815 13:88516202-88516224 GGTCCCACACAGATGGGACAAGG + Intergenic
1111480279 13:88815072-88815094 GGGTCCATTCAGATGGTTGTGGG + Intergenic
1111630465 13:90841775-90841797 GGTCCCACACAGATGGGACGTGG - Intergenic
1112785773 13:102950564-102950586 GGGGCCACACAGAGTGGTCCTGG + Intergenic
1114491285 14:23103738-23103760 TGGTCCAGCCAGATGGGCCTGGG - Intergenic
1116179702 14:41518278-41518300 GGTCCCACACAGATGGGACGCGG - Intergenic
1116573476 14:46546262-46546284 GGTCCCACACAGATGGGACATGG - Intergenic
1117626727 14:57647692-57647714 GGAAGAACACAGATGGGTCTAGG - Intronic
1117790230 14:59332601-59332623 GGTACCACACAGATGTGACTGGG - Intronic
1119471715 14:74904494-74904516 GGGTCCATACAGATGGTTGGGGG + Exonic
1120401907 14:84042976-84042998 TGGGTCCCACAGATGGGTCTAGG - Intergenic
1121974603 14:98391273-98391295 GGGGCCACAAAGCTGTGTCTAGG - Intergenic
1122041019 14:98987534-98987556 GGTCCCACACAGATGGGACGCGG - Intergenic
1122381299 14:101309048-101309070 GGTCCCACACAGATGGGACACGG + Intergenic
1124426937 15:29570596-29570618 GGGGCCACGCAGATGGCGCTCGG - Exonic
1124863973 15:33471285-33471307 GGTGACACACAGATGGGTATGGG - Intronic
1125213194 15:37239572-37239594 GGTCCCACACAGATGGGACGCGG + Intergenic
1128632429 15:69280359-69280381 GGGCACACACACATGGGTCTGGG - Intergenic
1129294559 15:74592759-74592781 GGGTCCTCAAAGTTGGGGCTGGG + Intronic
1130282743 15:82532212-82532234 GGGTCCTCTCAGAGGGTTCTGGG - Intergenic
1130298863 15:82665462-82665484 CGTTGCGCACAGATGGGTCTGGG + Exonic
1130304571 15:82704587-82704609 GGTTCCACACAGATGGGACAAGG - Intronic
1130558849 15:84943394-84943416 GGCTCCCCTCAGATGGGCCTGGG - Intronic
1131882493 15:96875201-96875223 GGTCCCACACAGATGGGACGTGG + Intergenic
1133101971 16:3485372-3485394 TGGGCCACACAGCTGGGCCTGGG - Intronic
1133221083 16:4319448-4319470 GGGTCCACAGAGATGGGTTGAGG + Intronic
1133226516 16:4343334-4343356 GGGCCCACAGAGATGGGCCCTGG + Intronic
1133869521 16:9674490-9674512 GGTCCCACACAGATGGGACGTGG + Intronic
1135025391 16:18995506-18995528 GGTCCCACACAGATGGGACACGG + Intronic
1135849158 16:25946979-25947001 GGGTCCAGACAGAAGGGCCTTGG + Intronic
1139225892 16:65233209-65233231 GGTCCCACACAGATGGGACGCGG + Intergenic
1139230576 16:65278626-65278648 GGTCCCACACAGATGGGACGCGG + Intergenic
1139943028 16:70619841-70619863 GGTCCCACACAGATGGGACGCGG + Intronic
1139943696 16:70624158-70624180 GGTCCCACACAGATGGGACGCGG + Intronic
1143714069 17:8754629-8754651 GGGTCTACTCTGATGGGTTTGGG + Intronic
1143882032 17:10037002-10037024 GGGTTCACACAGCTGGGGCCGGG - Intronic
1145080643 17:19891836-19891858 GGTCCCACACAGATGGGACGTGG + Intergenic
1145882597 17:28363394-28363416 GGTTCCACACAGATACCTCTTGG - Exonic
1145912030 17:28548486-28548508 GAGTCCACAGAGCTGGGGCTTGG - Intronic
1145912181 17:28549200-28549222 GGGGCCACACAGCTCTGTCTTGG + Intronic
1146597921 17:34185610-34185632 GGTCCCACACAGATGGGACGCGG - Intergenic
1148123819 17:45226815-45226837 GGGTCCCCACAGCTGGGACAAGG - Intronic
1148278924 17:46332042-46332064 GTGCCCACACAGAAGAGTCTGGG + Intronic
1148301139 17:46549904-46549926 GTGCCCACACAGAAGAGTCTGGG + Intronic
1148476771 17:47933817-47933839 GGGTCCACTCAGCTTGGTTTTGG - Intergenic
1152122363 17:78426604-78426626 GGAGACACACAGATGGGTGTGGG + Intronic
1152644221 17:81461387-81461409 GGGTGCACATAGCTGGGGCTGGG - Exonic
1152931454 17:83112156-83112178 GGGTCCACACAGACTGTTCCAGG - Intergenic
1155015877 18:21838829-21838851 GTATCAACACAGATGGTTCTTGG - Intronic
1156302271 18:35846230-35846252 GGTCCCACACAGATGGGACATGG - Intergenic
1159835075 18:73326973-73326995 GGTCCCACACAGATGGGACGCGG - Intergenic
1161217385 19:3101223-3101245 GTGTCCACACTGATGGGTGCTGG + Intronic
1161661743 19:5550807-5550829 GGTCCCACACAGATGGGACGCGG - Intergenic
1161931977 19:7346871-7346893 CGGTGCACACAGATGGTTTTGGG - Intergenic
1163124331 19:15236610-15236632 GGGTCCACAAGGATGGGTACCGG + Exonic
1163325596 19:16601108-16601130 GAGGTCACACAGCTGGGTCTGGG + Intronic
1164202481 19:23030194-23030216 GGTCCCACACAGATGGGACATGG + Intergenic
1165249258 19:34516330-34516352 GGTCCCACACAGATGGGACATGG - Intergenic
1166498917 19:43326876-43326898 GGTCCCACACAGATGGGACGCGG + Intergenic
1166507654 19:43381263-43381285 TGGTCCACACAGGAGGGTCAGGG + Intergenic
1166905772 19:46107423-46107445 GGGTCCGCACAGATGGGACATGG + Intergenic
1167046579 19:47053120-47053142 GGTCCCACACAGATGGGACGCGG + Intergenic
1167902172 19:52630108-52630130 GGTCCCACACAGATGGGACACGG - Intronic
1168051664 19:53833946-53833968 GGTCCCACACAGATGGGACGCGG - Intergenic
925828797 2:7876035-7876057 GGTCCCACACAGATGGGACTCGG + Intergenic
926815525 2:16795315-16795337 GGTCCCACACAGATGGGACGTGG + Intergenic
929076654 2:38084139-38084161 GGTCCCACACAGATGGGACATGG + Intronic
929684505 2:44022417-44022439 GGTCCCACACAGATGGGACACGG + Intergenic
930487342 2:52025487-52025509 GGTCCCACACAGATGGGACACGG + Intergenic
930750779 2:54932267-54932289 GGGACCAGCCAGATGAGTCTGGG - Intronic
930955119 2:57195303-57195325 GGTCCCACACAGATGGGACACGG - Intergenic
931625801 2:64254865-64254887 GGTCCCACACAGATGGGACACGG - Intergenic
932159438 2:69447025-69447047 GGTCCCACACAGATGGGACATGG + Intergenic
932973934 2:76577227-76577249 GGTCCCACACAGATGGGACGCGG + Intergenic
936883357 2:117281078-117281100 GGTCCCACACAGATGGGACGCGG - Intergenic
937046208 2:118853381-118853403 GTGTCCACACAGACTGGCCTTGG + Intergenic
937274070 2:120673086-120673108 GGGGCCAGACAGATGGGGGTGGG - Intergenic
938498736 2:131818684-131818706 GGGTGCTCACAGATGGGGATGGG + Intergenic
940216846 2:151311167-151311189 GGTCCCACACAGATGGGACATGG - Intergenic
941139540 2:161761865-161761887 GGGACCACACAGTTAGGTCAGGG - Intronic
941245330 2:163088724-163088746 CTGTCCACACAGATGAGTTTAGG + Intergenic
941983908 2:171490864-171490886 GAGTCCACACAGAACAGTCTTGG + Intergenic
944394162 2:199249262-199249284 GGTCCCACACAGATGGGACGCGG - Intergenic
945173482 2:207019584-207019606 GGTCCCACACAGATGGGACATGG - Intergenic
945376123 2:209080408-209080430 GGTCCCACACAGATGGGACGCGG - Intergenic
945394325 2:209301560-209301582 GGTCCCACACAGATGGGACGCGG - Intergenic
945430922 2:209763956-209763978 GAGCCCACACATATGTGTCTAGG + Intergenic
945554708 2:211263805-211263827 GGTTCCACACAGATGGGACACGG - Intergenic
945938342 2:215924708-215924730 GGTCCCACACAGATGGGACGTGG - Intergenic
946157194 2:217814784-217814806 GGGTCATCACAGAGGGGGCTGGG - Intronic
946419748 2:219558053-219558075 GGGGCCACACAGAGCGGGCTTGG + Exonic
946781023 2:223193214-223193236 GGTCCCACACAGATGGGACATGG + Intronic
947610666 2:231523018-231523040 GGATCCACTCTGATGGGCCTTGG - Intergenic
948930348 2:241127967-241127989 GGGCCCACACAGAAGGGGCCAGG + Intronic
1168997282 20:2142878-2142900 GGGCCCACAGAGATTAGTCTTGG - Intronic
1170106256 20:12756209-12756231 GGTCCCACACAGATGGGACGCGG - Intergenic
1171150728 20:22824450-22824472 GGGTCCACACAGACATCTCTTGG + Intergenic
1172110226 20:32540223-32540245 GGGCCCAGACAGATGTGTGTAGG + Intronic
1172781002 20:37437099-37437121 GTGGCCAGACAGCTGGGTCTGGG - Intergenic
1172890247 20:38259240-38259262 GTGTACACACACATGGCTCTTGG - Intronic
1173101936 20:40095685-40095707 GGTCCCACACAGATGGGACACGG - Intergenic
1173168491 20:40703296-40703318 GGCCCCACAGAGATGGGACTGGG + Intergenic
1173746544 20:45441824-45441846 GGGTCCATTCAGATGGGTGGGGG - Intergenic
1175507043 20:59493525-59493547 CCTTCCACACACATGGGTCTTGG - Intergenic
1175569521 20:60008479-60008501 GGGTCCACAGAGTTGGTACTGGG - Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1176044858 20:63087325-63087347 GGGTGTACACAGATGCGTCTGGG + Intergenic
1177462646 21:21433109-21433131 GGGTCAACACAGATGAGACCAGG - Intronic
1179157136 21:38860308-38860330 GGGTGCACACAGCTTGGTCTAGG + Intergenic
1179387579 21:40957287-40957309 GGTCCCACACAGATGGGACGTGG - Intergenic
1180051727 21:45334761-45334783 GTGTCCACACTGAAGGGGCTCGG - Intergenic
1181771453 22:25128681-25128703 GGGTGCAAAGAGATGGGGCTGGG - Intronic
1182181866 22:28357780-28357802 GGGTCCACATTGGTGGGTCAAGG - Intronic
1184803658 22:46777596-46777618 GGGAACACACAGAAGAGTCTGGG + Intronic
949875058 3:8621206-8621228 GGGTCCCCACATCTGAGTCTGGG - Intronic
950160602 3:10757922-10757944 AGGGTCACACAGCTGGGTCTGGG + Intergenic
951315117 3:21180102-21180124 GGGTCCACACAAGTGTGCCTTGG + Intergenic
952896036 3:38079653-38079675 GGTCCCACACAGATGGGACGTGG + Intronic
953599419 3:44348396-44348418 GGTCCCACACAGATGGGACACGG + Intronic
954144351 3:48626964-48626986 GGGTCCACACTGAAGGCCCTGGG - Exonic
954144849 3:48629434-48629456 GAGTGGACAGAGATGGGTCTGGG - Intronic
954366736 3:50150449-50150471 GGGAGAACACAGAAGGGTCTGGG + Intergenic
954969244 3:54637856-54637878 GGTCCCACACAGATGGGACGCGG + Intronic
955220499 3:57019348-57019370 GGGTGCACACACTTGGGTCCAGG - Intronic
956709237 3:72025325-72025347 GGTCCCACACAGATGGGACATGG - Intergenic
957059877 3:75473405-75473427 GGTCCCACACAGATGGGACATGG + Intergenic
958751020 3:98193336-98193358 GGTCCCACACAGATGGGACACGG - Intronic
959288331 3:104443292-104443314 GGTCCCACACAGATGGGACGCGG + Intergenic
959972245 3:112420938-112420960 GGTCCCACACAGATGGGACGCGG + Intergenic
960282854 3:115796879-115796901 GGTCCCACACAGATGGGACGTGG + Intergenic
960645956 3:119883636-119883658 GGGTCAACACAGTAGGGTCCAGG - Intronic
961164740 3:124755926-124755948 GGTCCCACACAGATGGGACGCGG + Intergenic
961293528 3:125866032-125866054 GGTCCCACACAGATGGGACATGG - Intergenic
961711604 3:128832565-128832587 GGTCCCACACAGATGGGACACGG + Intergenic
961881065 3:130061609-130061631 GGTTCCGCACAGATGGGACGTGG - Intergenic
962752466 3:138443912-138443934 GGGTCCACACAGATGGGTCTGGG - Intronic
962842752 3:139250984-139251006 GGGTCTGCTCAGATGTGTCTGGG - Intronic
963111819 3:141694660-141694682 GGTCCCACACAGATGGGACATGG + Intergenic
963319766 3:143799619-143799641 GGTCCCACACAGATGGGACATGG - Intronic
963663363 3:148153987-148154009 GGTCCCACACAGATGGGACATGG - Intergenic
963684352 3:148416684-148416706 GGTCCCACACAGATGGGACGTGG - Intergenic
964384396 3:156131797-156131819 GGGTCCAGTCAGGTGGGACTTGG + Intronic
964501000 3:157348032-157348054 GGCTCCACACAGCTGTGGCTAGG - Intronic
967212146 3:187178903-187178925 GGTCCCACACAGATGGGACGCGG + Intronic
967821374 3:193842356-193842378 GGCTCCACACAGAGGGGACAGGG + Intergenic
970532757 4:16999998-17000020 GGTCCCACACAGATGGGACATGG - Intergenic
973733901 4:53851167-53851189 GGGTGAAAACAGATGGGACTGGG - Intronic
974428377 4:61767666-61767688 GGTCCCACACAGATGGGACGTGG + Intronic
976391330 4:84507421-84507443 TGCTCCAGACTGATGGGTCTGGG - Intergenic
976739936 4:88347125-88347147 GGTCCCACACAGATGGGACATGG + Intergenic
977062491 4:92274868-92274890 GGTCCCACACAGATGGGACACGG + Intergenic
978001100 4:103557141-103557163 GGTCCCACACAGATGGGACGTGG + Intergenic
978303211 4:107293798-107293820 GGTCCCACACAGATGGGACATGG + Intergenic
978438629 4:108711360-108711382 GGTCCCACACAGATGGGACATGG - Intergenic
979146637 4:117254433-117254455 GGCTCCACACAGATGGGACATGG - Intergenic
979850290 4:125565014-125565036 GGTCCCACACAGATGGGACGCGG + Intergenic
981040263 4:140215827-140215849 GGTCCCACACAGATGGGACATGG - Intergenic
981482709 4:145254923-145254945 GGTCCCACACAGATGGGACATGG + Intergenic
982114590 4:152087175-152087197 GGGTCCTCAGAGATGTGTCAGGG - Intergenic
982535466 4:156602615-156602637 GGTCCCACACAGATGGGACATGG - Intergenic
983023891 4:162711434-162711456 GGTCCCACACAGATGGGACATGG - Intergenic
983345577 4:166522855-166522877 GGTCCCACACAGATGGGACATGG - Intergenic
983360425 4:166718633-166718655 GGTCCCACACAGATGGGACGCGG - Intergenic
983452353 4:167925227-167925249 GGTCCCACACAGATGGGACGTGG - Intergenic
984437282 4:179722779-179722801 GGTCCCACACAGATGGGACGTGG - Intergenic
985328163 4:188796224-188796246 GTGTTCACACAGACCGGTCTTGG + Intergenic
985828943 5:2213643-2213665 GAGACCACACAGGTGGGTCGGGG + Intergenic
986388898 5:7265918-7265940 GGTCCCACACAGATGGGACGCGG - Intergenic
986495633 5:8339097-8339119 GGGGCATCACAGGTGGGTCTGGG - Intergenic
987498102 5:18672236-18672258 GGTCCCACACAGATGGGACGCGG + Intergenic
989319343 5:40117041-40117063 GGGTCCACTCAGATGGTTGGGGG + Intergenic
989615140 5:43331316-43331338 GGTCCCACAAAGATGGGACTTGG + Intergenic
992394683 5:76359687-76359709 GGTCCCGCACAGATGGGTCACGG - Intergenic
992524157 5:77590428-77590450 GGGACCACACAGATGGCACATGG + Intronic
993192732 5:84700812-84700834 GGTCCCACACAGATGGGACGTGG - Intergenic
994532528 5:100987632-100987654 GGTCCCACACAGATGGGACGTGG + Intergenic
994775702 5:104033950-104033972 GGTCCCACACAGATGGGACATGG - Intergenic
995873405 5:116765570-116765592 GGGTCCATACACTTGAGTCTGGG - Intergenic
997746421 5:136303646-136303668 GGTCCCACACAGATGGGACACGG - Intronic
1000885300 5:166742469-166742491 GGTCCCACACAGATGGGACACGG + Intergenic
1000935622 5:167301265-167301287 GGTCCCACACAGATGGGACATGG + Intronic
1001153637 5:169254087-169254109 AACTCCACACAGCTGGGTCTGGG + Intronic
1002272521 5:178082022-178082044 GGAAGCACACAGATGGGTCTAGG - Intergenic
1004575241 6:16888289-16888311 GGTCCCGCACAGATGGGACTTGG - Intergenic
1005014638 6:21364885-21364907 GGTCCCACACAGATGGGACGTGG + Intergenic
1007610049 6:43143391-43143413 AGAGACACACAGATGGGTCTGGG - Intronic
1008476547 6:51940516-51940538 GGTCCCACACAGATGGGGCATGG - Intronic
1010586677 6:77663933-77663955 GGTCCCACACAGATGGGACGCGG + Intergenic
1010829672 6:80513683-80513705 GGGTCTGCACAGATGGGACGTGG + Intergenic
1011770922 6:90673590-90673612 GGTCCCACACAGATGGGACGTGG + Intergenic
1012066524 6:94557322-94557344 GGTCCCACACAGATGGGACGCGG + Intergenic
1012315844 6:97781931-97781953 GGTCCCACACAGATGGGACGCGG - Intergenic
1013951570 6:115788750-115788772 GGGACCACACAGATGTCACTGGG - Intergenic
1014023414 6:116616823-116616845 GGGGCCACCCAGAGGCGTCTTGG - Exonic
1014360140 6:120465644-120465666 GGTCCCACACAGATGGGACGTGG + Intergenic
1014555868 6:122842161-122842183 GGTCCCACACAGATGGGACGCGG - Intergenic
1015271393 6:131341213-131341235 GGTCCCACACAGATGGGACACGG - Intergenic
1015323850 6:131904018-131904040 GGTCCCACACAGATGGGACGCGG - Intergenic
1016019371 6:139219648-139219670 GGTTCCCCACAGATGTGTCTGGG + Intergenic
1016114122 6:140260788-140260810 GGTCCCACACAGATGGGACGTGG + Intergenic
1016518826 6:144925504-144925526 GGTCCCACACAGATGGGACGTGG - Intergenic
1016535741 6:145106527-145106549 GGTCCCACACAGATGGGACGCGG + Intergenic
1017389522 6:153923817-153923839 GGTCCCACACAGATGGGACGCGG - Intergenic
1017781696 6:157720450-157720472 GGGTCTACAGTGATGGGTTTAGG + Intronic
1019427020 7:982730-982752 GGGTGCACACGGATGGGGTTTGG + Intergenic
1021393644 7:20122935-20122957 GGTCCCACACAGATGGGACGTGG - Intergenic
1022710028 7:32841281-32841303 GGTCCCACACAGATGGGACACGG + Intergenic
1024381682 7:48704020-48704042 GGGTCCCCAAAAATGGATCTTGG + Intergenic
1024739233 7:52337023-52337045 GGTCCCACACAGATGGGACATGG + Intergenic
1025185948 7:56858527-56858549 GGACCCACACAGATGGGATTTGG - Intergenic
1025685978 7:63718414-63718436 GGACCCACACAGATGGGATTTGG + Intergenic
1025978873 7:66391681-66391703 GGACCCACACAGATGGGATTTGG - Intronic
1027157906 7:75781485-75781507 GGTCCCACACAGATGGGACAAGG - Intronic
1028670529 7:93396263-93396285 GGTCCCACACAGATGGGTCACGG - Intergenic
1028690196 7:93642193-93642215 GGTCCCACACAGATGGGACATGG - Intronic
1030311863 7:108077029-108077051 GGTTCTAAACAGATGGGTGTGGG + Exonic
1031525610 7:122819253-122819275 GGTCCCACACAGATGGGACGTGG - Intronic
1031776343 7:125912321-125912343 GGTCCCACACAGATGGGACACGG - Intergenic
1031777365 7:125919946-125919968 GGTCCCACACAGATGGGACTTGG - Intergenic
1033084736 7:138331361-138331383 GGTCCCACACAGATGGGACATGG - Intergenic
1033125434 7:138702962-138702984 GGGGTCACACAGATGCATCTGGG + Intergenic
1033577229 7:142697079-142697101 GGGTCCACACAGTTGGTTGTGGG + Intergenic
1033695905 7:143788839-143788861 GGTCCCACACAGATGGGACGCGG - Intergenic
1034256766 7:149728986-149729008 GGGTCCACGCAGCTGGGTCTGGG + Intronic
1034694404 7:153041313-153041335 GGGACAAGACAGGTGGGTCTAGG + Intergenic
1035422272 7:158739706-158739728 GGGTCCACTCACATGGGAGTGGG - Intronic
1035830348 8:2688571-2688593 GAGTCCTCACAAATGGGACTAGG - Intergenic
1036147839 8:6270857-6270879 GGCTCCACACAGGTGGGGCACGG + Intergenic
1036281501 8:7404768-7404790 GGTCCCACACAGATGGGACGCGG - Intergenic
1036523879 8:9517410-9517432 GGGAGCACACGGATGGGTCTAGG + Intergenic
1036705460 8:11043044-11043066 GGGCCCACCCAGAGGGGTCCTGG + Intronic
1037677698 8:21066041-21066063 TGGTACAAACAGAAGGGTCTGGG - Intergenic
1037786412 8:21905982-21906004 GGGTCCACACATCTGGGAGTGGG + Intergenic
1039501917 8:38024672-38024694 GGGTCCATTCAGATGGTTGTGGG - Intergenic
1039680455 8:39730132-39730154 GGATCCACAGACCTGGGTCTGGG + Intergenic
1040328797 8:46375546-46375568 GGGCCTACACAGATGGCTGTGGG - Intergenic
1041917515 8:63151675-63151697 GGGTCTGCACAGATGGGACACGG + Intergenic
1043353651 8:79389483-79389505 GGTCCCACACAGATGGGACGTGG + Intergenic
1043597436 8:81901915-81901937 GGTCCCACACAGATGGGACATGG + Intergenic
1043624031 8:82232530-82232552 GGGTCCACTCAGATGGTTGGGGG - Intergenic
1044922012 8:97177407-97177429 GGTCCCACACAGATGGGACATGG - Intergenic
1044925179 8:97203251-97203273 GGTCCCACACAGATGGGACGCGG - Intergenic
1045197543 8:99946202-99946224 GGTCCCACACAGATGGGACGCGG - Intergenic
1045644801 8:104288266-104288288 GGTCCCACACAGATGGGACGCGG - Intergenic
1046290269 8:112149970-112149992 GGGTGCACACAGATGGTTGTTGG + Intergenic
1046294137 8:112198155-112198177 GGTTCCACAAAGATGGGACATGG - Intergenic
1046386321 8:113512891-113512913 GGTCCCACACAGATGGGACGCGG + Intergenic
1046440032 8:114243669-114243691 GGTCCCACACAGATGGGACGCGG - Intergenic
1046512106 8:115214558-115214580 GGTCCCACACAGATGGGACGTGG - Intergenic
1047288289 8:123506944-123506966 GGGGCCAGAGAGATGGGACTTGG - Intronic
1047699367 8:127434060-127434082 GGTCCCACACAGATGGGACACGG - Intergenic
1048168415 8:132083615-132083637 GGTCCCACACAGATGGGACGCGG + Intronic
1048770593 8:137890655-137890677 GGTTGGACACAGCTGGGTCTTGG + Intergenic
1049206688 8:141366836-141366858 GGGTGCCCAGAGCTGGGTCTTGG - Intronic
1049325890 8:142021256-142021278 GGGTCCCCAGGGAAGGGTCTGGG + Intergenic
1049584011 8:143424684-143424706 GGGTCCACATGCATGTGTCTGGG + Intronic
1051052644 9:12950654-12950676 GGTCCCACACAGATGGGACATGG - Intergenic
1052163102 9:25290005-25290027 GGTCCCACACAGATGGGACGTGG - Intergenic
1052890715 9:33696965-33696987 GGGTCCACACAGTTGGTTGTGGG + Intergenic
1053059902 9:35022684-35022706 GGTCCCACACAGATGGGACACGG + Intergenic
1055011259 9:71568669-71568691 TGGTTCAAACAGTTGGGTCTGGG - Intergenic
1055233082 9:74087996-74088018 GGTCCCACACAGATGGGACGCGG - Intergenic
1055445733 9:76380419-76380441 GGGGCCTCACAGAAGTGTCTTGG - Intergenic
1055810067 9:80139744-80139766 GGTCCCACACAGATGGGACGTGG - Intergenic
1056061175 9:82886090-82886112 GGGGTCACACAGATGGGACATGG - Intergenic
1056102299 9:83311584-83311606 GGGGGCACACGGATGGGTCAGGG - Intronic
1056323907 9:85460979-85461001 GGTCCCACACAGATGGGACACGG - Intergenic
1056522466 9:87413259-87413281 GGTCCCACACAGATGGGACGCGG - Intergenic
1056882999 9:90414908-90414930 GGTCCCACACAGATGGGACGTGG - Intergenic
1057025424 9:91731381-91731403 GGGTCCCAAGAGATGGTTCTGGG - Intronic
1057173251 9:92976371-92976393 GGGTCCCCACAGTGGGCTCTGGG - Exonic
1057234867 9:93349938-93349960 GGTCCCACACAGATGGGACGTGG - Intergenic
1057279265 9:93698475-93698497 GGCTGCACACAGCTGGGTATGGG + Intergenic
1057684020 9:97217176-97217198 GGTCCCACACAGATGGGACATGG - Intergenic
1057727486 9:97578502-97578524 AGATACACACAGATGTGTCTGGG - Intronic
1058355249 9:104076965-104076987 GGGTCCACACAGATAACACTAGG + Intergenic
1059309609 9:113378985-113379007 GAATCTACACAGATGGGTCTTGG + Intergenic
1059606687 9:115842582-115842604 GGTCCCACACAGATGGGACGCGG + Intergenic
1059863467 9:118489051-118489073 GGTCCCACACAGATGGGACGCGG + Intergenic
1060231246 9:121827058-121827080 GGGTCCAAACCCATGGGACTCGG - Intronic
1061961270 9:133990508-133990530 GGGTCCGCACAGAGGAGGCTTGG - Intronic
1062016599 9:134294268-134294290 GGGTCCACACAGATGCCACCAGG + Intergenic
1062558409 9:137127792-137127814 GGGTCCACATGGAAGGGTCCTGG + Intergenic
1062689801 9:137835339-137835361 GGCGCCACACAGAAGAGTCTGGG - Exonic
1203488995 Un_GL000224v1:85955-85977 GGGTCCATTCAGATGGCTGTTGG + Intergenic
1203501616 Un_KI270741v1:27850-27872 GGGTCCATTCAGATGGCTGTTGG + Intergenic
1186542056 X:10410902-10410924 GGGCCCTCACAGTTGGGCCTGGG - Intergenic
1188431044 X:30105677-30105699 GGTCCCACACAGATGGGACGCGG - Intergenic
1189424085 X:40882519-40882541 GTGTCCACACAGAGTGGGCTGGG + Intergenic
1190360292 X:49643040-49643062 GGGTCCATTCAGATGGGTGGGGG - Intergenic
1190625720 X:52336747-52336769 GGGTCCCCACAGAAGGGACTAGG + Intergenic
1190761617 X:53442099-53442121 GGGACCACACAGGTGAGTCCAGG - Intergenic
1191104336 X:56763321-56763343 GGTTTCACACAGATGGGGGTGGG - Intergenic
1192829797 X:74740123-74740145 AGGTCCACAAGGATGAGTCTGGG - Exonic
1193941519 X:87684223-87684245 GGTCCCACACAGATGGGACGCGG - Intergenic
1194293604 X:92103612-92103634 GGTCCCACACAGATGGGACGTGG + Intronic
1194591185 X:95801877-95801899 GGGTCAACACCGAAGGGTCAAGG + Intergenic
1194873779 X:99162813-99162835 GGTCCCACACAGATGGGACGTGG + Intergenic
1195841505 X:109180755-109180777 GGTCCCACACAGATGGGACATGG - Intergenic
1196330845 X:114469097-114469119 GGTCCCACACAGATGGGACGCGG - Intergenic
1196341698 X:114604678-114604700 GGTCCCACACAGATGGGACACGG + Intronic
1197499741 X:127228934-127228956 GGTCCCACACAGATGGGACACGG - Intergenic
1197793655 X:130279369-130279391 GGTCCCACACAGATGGGACATGG - Intergenic
1198983736 X:142426941-142426963 GGTCCCACACAGATGGGACACGG + Intergenic
1199576498 X:149318000-149318022 GGTCCCACACAGATGGGACATGG - Intergenic
1200091207 X:153636958-153636980 GGGTGCACACAGGCGGCTCTGGG - Intergenic
1200611123 Y:5328158-5328180 GGTCCCACACAGATGGGACGTGG + Intronic
1202304009 Y:23448558-23448580 AGGTTCACACAGATGTGTATGGG - Intergenic
1202566801 Y:26222033-26222055 AGGTTCACACAGATGTGTATGGG + Intergenic