ID: 962752516

View in Genome Browser
Species Human (GRCh38)
Location 3:138444266-138444288
Sequence CCTCAGATGGGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 495}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962752516 Original CRISPR CCTCAGATGGGGAGGGTGGA GGG Intronic
900269759 1:1781055-1781077 GCAGGGATGGGGAGGGTGGAGGG + Intergenic
900401134 1:2473400-2473422 CCCCAGTTGGGGAGAGTGCATGG - Intronic
900422738 1:2562615-2562637 CCTCAGCTGGGGAGGTGGGCCGG + Intronic
900531140 1:3154050-3154072 CCGCAGATTGGGAGAGTGCACGG - Intronic
900605397 1:3521484-3521506 CCTGGGATGGGGAGGGTGTTGGG - Intronic
900893079 1:5463670-5463692 CCTCATGTGGGTAGGGTGGTAGG - Intergenic
901028747 1:6293833-6293855 CCTAAGATTGGAATGGTGGAGGG - Intronic
901183167 1:7355731-7355753 CCTGAGAGGGGAGGGGTGGAAGG - Intronic
901529532 1:9844412-9844434 CCAAAGATGGGGAGGCTGGGAGG - Intergenic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
902542860 1:17166780-17166802 CCTGAGATGTGGATGGGGGAAGG + Intergenic
902720913 1:18303388-18303410 CCTCAGCTGGGGAGGCTGCCGGG - Intronic
902939205 1:19787607-19787629 CATCAGATGGGGAAGGGAGATGG + Intronic
903766535 1:25738597-25738619 CCTCAGCTGGGAAGGCTTGAAGG + Intronic
904037457 1:27566591-27566613 ACTCAGATGGGGTGGGAAGAGGG + Intronic
905508299 1:38498158-38498180 CCTGAGAGGTGGAGGGTGGGGGG - Intergenic
906510089 1:46405789-46405811 CCTCAGGTAAGGTGGGTGGAGGG + Exonic
906940428 1:50250958-50250980 CTTTAGATGGTGAGGGTGGCAGG + Intergenic
907112186 1:51936194-51936216 GCTCAGATGAGGATGGGGGAAGG - Intronic
909228080 1:73051227-73051249 ACTCAGGAGGGGAGGGTGGATGG + Intergenic
909513593 1:76482873-76482895 CCTCTGGTGGGGTGGGGGGAGGG - Intronic
910727214 1:90351661-90351683 CCTCATATGGGTGGGGTGGGTGG - Intergenic
910960968 1:92762812-92762834 TCTCAGAGTGGGAGGGTGGGAGG + Intronic
913260077 1:116989831-116989853 CCTCAGATGGTGAGGGTGAGGGG - Exonic
913372987 1:118121203-118121225 CATCAGAGAGGGTGGGTGGAGGG + Intronic
915724364 1:158007304-158007326 CCTCAGAAGGGGTGGAGGGAAGG + Intronic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
917597471 1:176543652-176543674 CCACACCTGGGGATGGTGGAAGG + Intronic
918812280 1:189137820-189137842 CCTGTTATGGGGTGGGTGGAGGG + Intergenic
919723633 1:200866909-200866931 CCTTAGATGTTGAGGGTGCAGGG + Intergenic
919765909 1:201127272-201127294 ACCCAGAAGGGGAGGGAGGAGGG + Intergenic
919822848 1:201483833-201483855 CCTCAGATGTGGAGGGAGGTAGG - Exonic
920513183 1:206565717-206565739 CCTGAGACAGGGAGGATGGAGGG + Intronic
920646715 1:207809121-207809143 CCTATGGTGGGGAGGGAGGAGGG - Intergenic
922384293 1:225066648-225066670 ACTCAGGTGGGAAGGGTGGGAGG - Intronic
923316511 1:232785658-232785680 CCTCTTGTGGGGTGGGTGGAGGG - Intergenic
924555973 1:245118933-245118955 CCTCAGCTAGGGAGAGGGGAGGG + Intronic
1063522695 10:6755192-6755214 TCTCAGTTGGGGCAGGTGGATGG + Intergenic
1066048855 10:31617623-31617645 CCTGAGGTGGGCAGGGTGGATGG + Intergenic
1066202006 10:33150861-33150883 CCTCGGAGGTGGAGAGTGGATGG + Intergenic
1067773550 10:49144853-49144875 CCTGAGCTGGGGAGGGCAGAGGG - Intergenic
1067944236 10:50680249-50680271 CCTCACATGGGGCTGGGGGAAGG + Intergenic
1068659961 10:59613525-59613547 CCTCACATGGGAAGGGGTGAGGG + Intergenic
1069226642 10:65953533-65953555 CCTGTCATGGGGTGGGTGGAGGG - Intronic
1069448576 10:68497164-68497186 CCTCAGATGGGAATGGAGGGTGG - Intronic
1069852822 10:71421334-71421356 CCTCAGGTGGGGCAGGTGGTGGG - Intronic
1070582043 10:77728520-77728542 CCTCATAGGGGTATGGTGGATGG - Intergenic
1071083181 10:81837492-81837514 CCACAGATGTGGGGGGTGGGGGG - Intergenic
1071599219 10:86948845-86948867 CCTCAGATGGCTGAGGTGGAAGG + Intronic
1071646080 10:87361558-87361580 CCTCACATGGGGCCGGGGGAAGG + Intronic
1071862394 10:89687407-89687429 CTTCAGATGGGGTGGCTGAAGGG + Intergenic
1072089322 10:92111662-92111684 CCTAGGATGGGGAAGCTGGAGGG + Intronic
1072916528 10:99540506-99540528 CGACAGAAGGGGAAGGTGGAAGG + Intergenic
1073255202 10:102146650-102146672 CCTGTGGTGGGGAGGGAGGATGG - Exonic
1073349929 10:102812573-102812595 CCTAAAATGGGGAGGTAGGAAGG - Exonic
1073756101 10:106582341-106582363 GCAGAGATGGGGAGGGTGAATGG - Intronic
1074219032 10:111418164-111418186 CCTGAGATTGGTAAGGTGGAGGG - Intergenic
1074885396 10:117689159-117689181 CCCCAGTTGTGGAGGGAGGAAGG - Intergenic
1075002467 10:118808698-118808720 CAGCAGAGGGGCAGGGTGGAGGG - Intergenic
1075576106 10:123578697-123578719 CCTCAGAAGGGTAGGGAGGAGGG - Intergenic
1075663111 10:124212029-124212051 CCACAGACATGGAGGGTGGAGGG - Intergenic
1075706477 10:124504971-124504993 CCACAGATGCTCAGGGTGGATGG - Intronic
1076009180 10:126973375-126973397 CCTCAGCTGGGCATGGTGGTGGG - Intronic
1076667743 10:132102656-132102678 CCTCACAGAGGGAGGGTGAAAGG - Intergenic
1076746753 10:132518349-132518371 CCTCAGATGGGGATGGGGAGTGG - Intergenic
1076798731 10:132811067-132811089 CCTGACATGGGGAGTGGGGATGG + Intronic
1077117325 11:891080-891102 CCTCAGAGTGGGATGGGGGAAGG + Intronic
1078420968 11:11212539-11212561 CCTCAGAGTGGCAGTGTGGAGGG - Intergenic
1079032522 11:16996390-16996412 TCTCAGATGGGATAGGTGGAGGG - Intronic
1079108573 11:17590287-17590309 ACTCAGATGGGGAAGGCTGAGGG - Intronic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1080242880 11:30147247-30147269 CCACAGATGGGGGTGGGGGAAGG + Intergenic
1081671359 11:44944430-44944452 CAGCAGATGGGGAGGTGGGAGGG - Intronic
1081981184 11:47268339-47268361 ACTCACATGGGGATGGTGGATGG - Exonic
1081998445 11:47378747-47378769 GCTAAGCTGGGGAGGGAGGATGG + Intergenic
1082986561 11:59174384-59174406 CATCAGAAGGTGAGGGTGGAGGG + Intronic
1083568348 11:63740262-63740284 ACTAAGATGGGGAGGTTAGAAGG - Intronic
1084189160 11:67491209-67491231 CCTCAGAGCTGGTGGGTGGAGGG - Intergenic
1084418331 11:69047628-69047650 CCTCTTTTGGGGAGGGGGGAGGG - Intergenic
1084470370 11:69355940-69355962 TCCAAGATGGGGAGGGAGGAGGG + Intronic
1084769063 11:71330998-71331020 CCTCAGATGGAGAGAATGGAGGG + Intergenic
1085514095 11:77102452-77102474 GCACTGATGGGGAGGGTGGTGGG - Intronic
1085533137 11:77203314-77203336 GCACACATGGGGAGGGTTGATGG + Intronic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1086051831 11:82601276-82601298 CCTCACATGGGAAGGGGCGAGGG + Intergenic
1086490657 11:87355122-87355144 CATGAGACGGGGAAGGTGGATGG - Intergenic
1086528664 11:87758551-87758573 CCTGTCATGGGGTGGGTGGAGGG - Intergenic
1088098666 11:106129946-106129968 CCTTAGATGGCAAGGGTGAAGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088578257 11:111293212-111293234 CCTGTCATGGGGTGGGTGGAGGG + Intergenic
1088617123 11:111642124-111642146 CACCAAATGCGGAGGGTGGAGGG + Intronic
1090406456 11:126478428-126478450 TCTCAGAAGGGGAGTGGGGATGG + Intronic
1091369508 11:135046875-135046897 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369523 11:135046926-135046948 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369538 11:135046977-135046999 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369553 11:135047028-135047050 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1091369568 11:135047079-135047101 CCTGAGACGGTGGGGGTGGAGGG - Intergenic
1092097098 12:5851760-5851782 CATCAGAGGTGGGGGGTGGAAGG + Intronic
1092944707 12:13441905-13441927 CACCAGATGAGGAAGGTGGAAGG - Intergenic
1092975999 12:13745469-13745491 CCTCAGAAGGGCAGGCTGGCAGG - Intronic
1095679703 12:44960007-44960029 TTTCAGATGTGAAGGGTGGATGG + Intergenic
1096343076 12:50819253-50819275 CCTCAGATGGGCTGAGTGAAGGG + Intronic
1096596700 12:52700440-52700462 CCACAGAAGGTGAGGGAGGAAGG + Intronic
1097036637 12:56128748-56128770 CCCCAGATGGAAGGGGTGGAAGG - Intronic
1097458805 12:59834378-59834400 CCCCAGATGGTGGGGGTGGGGGG - Intergenic
1097689856 12:62724526-62724548 CCTCAGAGGGAGAGGGTAGGTGG - Intronic
1097935928 12:65250936-65250958 CCTTAGATGGGGATTGAGGATGG + Intergenic
1100478916 12:94959405-94959427 CCCCACCTGGGGAGGCTGGAGGG - Intronic
1101397629 12:104362474-104362496 CCGCAGTGGGGGAGGTTGGAAGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101729203 12:107412790-107412812 CACTAGATGGGTAGGGTGGAGGG - Intronic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1102285812 12:111655495-111655517 ACTCTGATGGGGGGTGTGGAAGG - Intronic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1102759789 12:115375285-115375307 GCTCAGATGAGGAGAGAGGAAGG + Intergenic
1103070514 12:117937360-117937382 CTTGAGAAGGGTAGGGTGGAGGG - Intronic
1103329227 12:120142394-120142416 CCTCTGTTAGGCAGGGTGGATGG + Intronic
1103594162 12:122013548-122013570 CCTTAGGTGTGGATGGTGGATGG - Intergenic
1104004738 12:124884127-124884149 CCTCAGATGGGGAGAATGAAAGG - Intergenic
1104664577 12:130638652-130638674 CAACAGATGGGGAGGGGGAAAGG - Intronic
1104675148 12:130707354-130707376 CCTCCCATGGGGAGGGAGGGAGG + Intronic
1104687684 12:130798929-130798951 CGACAGATGGGCAGGGTGAAGGG + Intronic
1104966812 12:132512092-132512114 CCTCAGATGGGTGGGCAGGAAGG - Intronic
1106232762 13:27833994-27834016 ACTCTGGTGGGGAGGGTGGGAGG - Intergenic
1106697110 13:32187021-32187043 CCTCTAAAGGGGTGGGTGGAGGG - Intronic
1108057551 13:46499498-46499520 GCTCAGATTGGGAATGTGGATGG + Intergenic
1108070460 13:46623852-46623874 ACAGAGATGGGGAGGGGGGAGGG - Intronic
1108213547 13:48161530-48161552 CCTCAGGTGGGGAGGGCACATGG + Intergenic
1108490184 13:50974243-50974265 GCTCAGATGGGAAGTCTGGATGG - Intergenic
1108825432 13:54407655-54407677 TCTCCAATGGGGAGGGTGGAGGG - Intergenic
1109177727 13:59176708-59176730 CCCCAGCTGGGGAGGGAGTAGGG - Intergenic
1110159595 13:72359570-72359592 CCTGTCATGGGGAGGGGGGAGGG + Intergenic
1110347376 13:74464342-74464364 CCACAGCTTGGGAGGGTGTAGGG - Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1112476074 13:99731723-99731745 CCCTGGATGGGGAGGGAGGAAGG + Intronic
1113531662 13:111031973-111031995 GGTCAGCTGGGGAGTGTGGAGGG + Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1114260407 14:21032509-21032531 CAACAGATGAGGAAGGTGGAGGG - Intronic
1114345815 14:21793678-21793700 CATCAGGTGTGGAGGGTAGATGG + Intergenic
1114613829 14:24058059-24058081 CCTCAGGTCGGGTGGGTGCAGGG + Exonic
1114909798 14:27176535-27176557 CCTCACATTGGGAGAGAGGAAGG + Intergenic
1116191734 14:41674044-41674066 TCTCAGATGGGGCGGCTGGCTGG + Intronic
1117118767 14:52546444-52546466 CCCCAGAGGTGGAGGATGGAGGG - Intronic
1117201871 14:53398620-53398642 CCTGAGATGGGGAGTGCAGAAGG + Intergenic
1119159322 14:72440017-72440039 CCACAGCTGGGGAGGGTGTAAGG - Intronic
1119614972 14:76093000-76093022 CCTGAGATGGTGAGGGCTGATGG - Intergenic
1119711820 14:76828024-76828046 CCTCAGACAGGGAAGGGGGAAGG + Intronic
1119745309 14:77039764-77039786 CCACAGATGGGGAGGGAGTTCGG - Intergenic
1120194047 14:81463876-81463898 CCTTATATGGGAAAGGTGGAGGG - Intergenic
1120951935 14:90049602-90049624 CCCCTGATGGGGAGGGAGGGAGG + Intergenic
1121674250 14:95739594-95739616 CCTCAGATGATGAAAGTGGAAGG + Intergenic
1121697531 14:95926007-95926029 ACTCAGATGTTGAGGATGGAGGG - Intergenic
1121709574 14:96027588-96027610 GCTCTGCTGGGGAGGGTGGCAGG - Intergenic
1121762036 14:96454025-96454047 CATCGGATAGGGAGGATGGATGG - Intronic
1122115209 14:99524017-99524039 GCTCTGATGGGGTGGGGGGAGGG - Intronic
1122437392 14:101709477-101709499 TCTCAGATGAGGAGGATGCAGGG + Intergenic
1123736786 15:23192502-23192524 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124287485 15:28415480-28415502 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1124288007 15:28421182-28421204 CCTCAGTTGGGGAAGGAGCAAGG + Intergenic
1125202015 15:37108346-37108368 CCAGAGATGGGGTGGGTGTAGGG - Intergenic
1125921179 15:43526864-43526886 TCTCAGGTGGGGAAGCTGGAGGG - Exonic
1127224630 15:56917165-56917187 CCCCAGATACGGAGGGCGGACGG - Intronic
1127430603 15:58903537-58903559 CATCTGACGGGGAGGGGGGAGGG + Intronic
1127974899 15:63990064-63990086 CCACAGAGGGTGAGGGTGGGTGG - Intronic
1128647810 15:69389797-69389819 CCTCAGATGGGAGGGGAGGGAGG + Intronic
1129182577 15:73886506-73886528 CCACAGAAGGGAAGGGTGCAGGG + Exonic
1129352925 15:74967649-74967671 CCTCTGCTGGGGTGGCTGGAAGG + Intronic
1129655717 15:77524563-77524585 GGTCAGATGGGGAGGAAGGAGGG - Intergenic
1129703358 15:77780773-77780795 CCTCACATGGTGGGGGTGGGGGG - Intronic
1130051494 15:80487388-80487410 GTTCAGATGGGGCGCGTGGAGGG + Intronic
1130870180 15:87965381-87965403 CCACAGATGGGGAGCCGGGAAGG + Intronic
1132653367 16:1031407-1031429 CCTCCGATGGCCATGGTGGATGG - Intergenic
1132674714 16:1116934-1116956 CCTGAGTTGGGGAGGGTAGGCGG - Intergenic
1133074935 16:3272794-3272816 CCTCAGAGGTGGAGGTTGCAGGG - Intronic
1133100408 16:3475932-3475954 GCTCAGATGGGGAGAGAGGCTGG + Intronic
1133398134 16:5464684-5464706 GCCCAGCTGTGGAGGGTGGATGG + Intergenic
1134256642 16:12617830-12617852 CCACAGATGGGGTTGGTGGGAGG - Intergenic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134729561 16:16449782-16449804 CCTCATATGTGGAAGTTGGAAGG + Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135067404 16:19322136-19322158 CCTAAGATCCGCAGGGTGGATGG - Intronic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1135565050 16:23505637-23505659 CCAAAGGTGGGGAGGGTGAATGG - Intronic
1135950565 16:26910194-26910216 CCTGAGATGGGGATGATGGGAGG - Intergenic
1136369200 16:29825497-29825519 CCATAGATGGCGAGGGTAGAAGG + Intronic
1136738712 16:32491370-32491392 CCTGTCATGGGGACGGTGGAGGG - Intergenic
1136922799 16:34345888-34345910 CCAGAGCTGGGGAGGGAGGATGG - Intergenic
1136981774 16:35065918-35065940 CCAGAGCTGGGGAGGGAGGATGG + Intergenic
1136991820 16:35157199-35157221 ACTCAGAAGGGGAGGGTGGGAGG + Intergenic
1137036671 16:35574663-35574685 CCACAGATGGGAAGGGTAGAGGG - Intergenic
1137546955 16:49411210-49411232 TCTCAGCTGGGGTGGGTGGCAGG - Intergenic
1138006547 16:53342844-53342866 CCTCAGATGGCGGGAGAGGAAGG + Intergenic
1138391740 16:56675539-56675561 CCTCAGAGGAGGAGCATGGAGGG + Intronic
1139327610 16:66164320-66164342 CCTCAAATGGGGCAGGGGGAAGG + Intergenic
1140239253 16:73186239-73186261 CCACAGATGGTGAGGGGGCATGG - Intergenic
1140503872 16:75457542-75457564 CCTCAGTTCTGGAGGCTGGAAGG - Intronic
1140546996 16:75820327-75820349 CTGCAGATGGGCATGGTGGAAGG + Intergenic
1140562995 16:76005755-76005777 ACTCAGAAGGGGAGGGTAGGTGG + Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141733097 16:85835313-85835335 CCTCAGGTCGGGAGGGTGCTGGG - Intergenic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1142031900 16:87842694-87842716 CCTCAGCAGGGCAGGGTGGCGGG - Intronic
1142182227 16:88676897-88676919 TCGCTGATGGGGATGGTGGAAGG - Intergenic
1203014501 16_KI270728v1_random:340421-340443 CCTGTCATGGGGACGGTGGAGGG + Intergenic
1203032836 16_KI270728v1_random:613580-613602 CCTGTCATGGGGACGGTGGAGGG + Intergenic
1143451287 17:7038375-7038397 CCTCAGCCAGGGAGGGTGGGCGG - Exonic
1143652240 17:8270503-8270525 CCACAGATGGTGAGGGGGGCTGG + Intergenic
1144864877 17:18329009-18329031 CCCCAGCTGGGGAGTGTGGCAGG + Intronic
1145815615 17:27793184-27793206 GGACAGATGGGGAGGGTGGGGGG + Intronic
1146015921 17:29233494-29233516 ACTCAGGAGGGGAGGGTGGAAGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146666373 17:34707248-34707270 GCTGAGATGAGGAGGGTGGGAGG - Intergenic
1147586600 17:41656755-41656777 CCTTCCATGGGGAGGGAGGAAGG + Intergenic
1148436964 17:47692913-47692935 TCTCCGAGGGGGAGGATGGAAGG - Intergenic
1148461812 17:47843452-47843474 CCTCAGATGGGGTGCCTGGCAGG - Intergenic
1148855354 17:50576115-50576137 CCTCAGATGGGGACCTGGGAGGG - Exonic
1148866564 17:50631787-50631809 AGTCAGTTGGGGAGGGAGGATGG + Intergenic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150780259 17:68116214-68116236 TCTCAGATGGGGTGGCTGGCCGG + Intergenic
1151254680 17:72867127-72867149 CCTCTGATTGGTAGGGAGGAGGG + Intronic
1151328680 17:73394145-73394167 CCTTGGATGGAGAGGCTGGAGGG + Intronic
1151529154 17:74693318-74693340 CCTTTGAGAGGGAGGGTGGATGG + Intronic
1151759080 17:76090502-76090524 CGTCAGATGGGGATGGGGAAGGG + Intronic
1152126976 17:78453087-78453109 CTCCAGATGGGGAGGCTTGAAGG - Intronic
1152490016 17:80624944-80624966 ACCCCGATGGGGAGTGTGGAAGG + Intronic
1153947068 18:10027544-10027566 TCTGGGATGGGGAGGCTGGATGG + Intergenic
1154201897 18:12306090-12306112 CCACAGATCGGGAGGGTAGGGGG + Intergenic
1157219236 18:45813758-45813780 CCTGTCATGGGGTGGGTGGAGGG + Intergenic
1158811915 18:61047533-61047555 CATAACATGGGGAGGGTGAAAGG + Intergenic
1159023391 18:63161505-63161527 GGTCAGATGGGGAGGGGCGAGGG - Intronic
1159626036 18:70696056-70696078 CTACAGATGGGGAGGGAGTAAGG - Intergenic
1159748478 18:72270054-72270076 CCTGTGATGGGGTGGGGGGAGGG + Intergenic
1160017567 18:75156393-75156415 TTTCAGATGTGGAGGGTTGATGG - Intergenic
1160033149 18:75279508-75279530 CCTCCCATGGGAAGGCTGGATGG + Intronic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1160953917 19:1680942-1680964 AGGCAGATGGGGAGGCTGGAAGG + Intergenic
1161091404 19:2361513-2361535 CCTGAGATGGGGTGGGTTGTTGG + Intergenic
1161423304 19:4187636-4187658 GCACAGATGGGGAGGATGAAAGG + Intronic
1161595633 19:5149783-5149805 CACCAGCTGGGGAGGCTGGAAGG + Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162286142 19:9740529-9740551 CCTAAAATGGGGAGGTTTGAGGG - Intergenic
1162389117 19:10378490-10378512 CCTTAGCTGGGGTGGGTGGAAGG - Intronic
1162799102 19:13101268-13101290 CCTCAAATGGGAAGGAGGGAGGG + Intronic
1163417861 19:17197509-17197531 CCCCAGATGTTGAGTGTGGAGGG - Intronic
1163418761 19:17202651-17202673 GCTCTGTTGGGGAGGGTGCAGGG - Intronic
1163514768 19:17756142-17756164 CCCCAGCTGGGGAGGGAGCAAGG - Intronic
1163551303 19:17967531-17967553 CCTGGGAGGGGGAGGGTGCAGGG + Intronic
1164401364 19:27904478-27904500 CCTCAGCTAGGGAGAGTGGCTGG - Intergenic
1164401533 19:27905417-27905439 CCTTAGATGGGGAGGTTGGTGGG - Intergenic
1165006920 19:32814872-32814894 CCTCCCATGGTGAGGGTGGGGGG - Intronic
1165115113 19:33523910-33523932 CCCCTGATGGGGAGGGGAGAGGG - Intergenic
1165115130 19:33523955-33523977 CCTCTGATGGGGAGGGGTGAGGG - Intergenic
1165461174 19:35945125-35945147 ACTCTGATGGGGAGGGTGTCGGG + Exonic
1165462427 19:35952010-35952032 GCTACCATGGGGAGGGTGGATGG + Intergenic
1165995458 19:39840561-39840583 CCTGAGGTGGGGAGTGGGGAGGG - Intronic
1166186837 19:41145281-41145303 ACTCAGAGGGGAAGGGTGGGAGG - Intergenic
1166201208 19:41238945-41238967 CCTGACATAGGGAGGGAGGATGG + Intronic
1166228816 19:41413761-41413783 GCAAAGATGGGGTGGGTGGAGGG - Intronic
1166602115 19:44105667-44105689 CTCAAAATGGGGAGGGTGGAAGG - Intronic
1167134818 19:47609916-47609938 CCTCAGCTGGGGGTGGGGGAGGG - Intronic
1167353664 19:48991220-48991242 CCACAGACGGAGAGGGTGCAGGG - Intronic
1167699558 19:51034496-51034518 GCTGAGATGGGGAGGGTGGTGGG + Intronic
1168153362 19:54460610-54460632 CCTGAGGTGGGGAGGCTGGGAGG + Intronic
1168315462 19:55483054-55483076 CCGCAGATGGGGCAGGTGAAGGG - Exonic
1168661518 19:58171203-58171225 CCACTGAGGGGAAGGGTGGAAGG - Intergenic
925785367 2:7427234-7427256 CATCAGATGAGGAAGGTGCATGG + Intergenic
925976709 2:9146790-9146812 CATCAGATGTGGAGGATGGATGG - Intergenic
926058991 2:9793494-9793516 CCCCACGTGGGGAGGGTGGGGGG + Intergenic
926234994 2:11034372-11034394 ACTCAGAGGGGGAGGGTGGTTGG - Intergenic
927064789 2:19460545-19460567 CATCACCTGGGGATGGTGGATGG - Intergenic
927935218 2:27072262-27072284 CCTCCGGGGGGTAGGGTGGAGGG - Intergenic
928718766 2:34095073-34095095 CCTCTCATGGGGTGGGGGGAGGG - Intergenic
929193410 2:39161650-39161672 CCTGAGAAAAGGAGGGTGGATGG + Intergenic
929564707 2:42977066-42977088 CCTCAGCTGGGGTGGGTGGGAGG + Intergenic
929565059 2:42978860-42978882 CCTCAGAAGGACAGGGAGGAGGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931442977 2:62304408-62304430 CTTCAGGTGTGGAGGGAGGAGGG - Intergenic
932378640 2:71261367-71261389 CTTTAGAGGGGGAGGGTTGAAGG + Intergenic
932406128 2:71513565-71513587 TCACTGATGGGGAGGGAGGAGGG + Intronic
932752118 2:74377878-74377900 CCTCTGGTTGGGAGAGTGGAAGG - Intronic
934992432 2:98930969-98930991 CCTTAGATGGGGTGGGGGGGTGG - Intronic
935141392 2:100355966-100355988 CTTCTGATGGGGAGGGGGAAGGG - Intergenic
935262682 2:101368869-101368891 CCACAGTTCTGGAGGGTGGAAGG - Intronic
935698331 2:105789090-105789112 CCTCAGCTGAGGAAGGTGGGTGG - Intronic
936079768 2:109424110-109424132 CCTGAGATGGGGAGGTTTGTGGG + Intronic
936522496 2:113220046-113220068 CCTCTGCTGGGCAGGATGGATGG - Intronic
937820603 2:126306271-126306293 GCTGAGTTGGGGAGGGTAGAAGG - Intergenic
938291822 2:130154641-130154663 GCTGACATGGGGAGGGCGGATGG + Intronic
938464726 2:131518323-131518345 GCTGACATGGGGAGGGCGGATGG - Intergenic
938722502 2:134079010-134079032 GGTCAGCAGGGGAGGGTGGAGGG + Intergenic
938985378 2:136570420-136570442 CCACAGATGTGGATGGGGGAGGG + Intergenic
939229940 2:139411458-139411480 CCTCAGATGGCGGGGGTGGGAGG - Intergenic
939723941 2:145690804-145690826 ACTAAGATGGGGAGGGAGGGTGG + Intergenic
939859533 2:147401545-147401567 ACTCAGTTGTGGATGGTGGATGG - Intergenic
939914420 2:148021376-148021398 CCAAAGAGGAGGAGGGTGGAGGG - Intronic
939961884 2:148572503-148572525 CCTCAGAGGGGTGGGGAGGAGGG - Intergenic
940112283 2:150168096-150168118 CCTTAGAAGGGGAAGGTGTAGGG + Intergenic
943033744 2:182716006-182716028 CCGCGGGCGGGGAGGGTGGATGG - Intergenic
943648835 2:190435062-190435084 CCTCAGATGGAGAGGGGGGTTGG - Intronic
943872892 2:193024622-193024644 CCACAGGTGGGGAGGGTGCAAGG - Intergenic
945735219 2:213590353-213590375 CCAAAAATGGGGAGGGTGAATGG - Intronic
945811895 2:214559019-214559041 ACTCTGATGGGGTGGGGGGAGGG - Intronic
946237390 2:218332541-218332563 GCTGAGATGGGGAAGGAGGAAGG - Intronic
946368709 2:219267018-219267040 CAGCAGATGGGCAGGGTGGAGGG - Intronic
947537309 2:230948299-230948321 CAGGAGATGGGGAGGGAGGAAGG - Intronic
947833507 2:233158885-233158907 CCTCAGCTGAGGTGGGTGGGGGG - Intronic
948539810 2:238682531-238682553 CCACAGATGGGGCTGGGGGATGG + Intergenic
948593285 2:239064491-239064513 CAACAGAAGGGGAGGGAGGAAGG + Intronic
948882533 2:240867505-240867527 CCCCAGGTGGGGTGGGTGGAGGG + Intergenic
948908002 2:240988984-240989006 GCACACATGGGGAGGGTGGCTGG + Intronic
1169344790 20:4821646-4821668 CCTGTGCTGGGGAGGCTGGAAGG - Intronic
1170158358 20:13288543-13288565 CCACAGATGGCGAGGGTGACTGG + Exonic
1170529926 20:17281107-17281129 CCTCAGATGGAGAGTCTTGAAGG - Intronic
1170799966 20:19582897-19582919 AGTCGGATGGGGAGGGTGGGAGG + Intronic
1171358921 20:24572913-24572935 ATTCAGATGGGTAGTGTGGATGG + Intronic
1171489828 20:25508956-25508978 CCTCACATGGGCAGGCTGAAAGG - Intronic
1172123086 20:32609860-32609882 CCTCAGATGGAGAGTGAGGGGGG - Intergenic
1172149383 20:32779694-32779716 CCCCAGCTGGTGAGGGAGGAGGG + Intronic
1172448174 20:35003825-35003847 CCTCAGGTGGGGTGGGAGGTGGG - Intronic
1172477406 20:35249126-35249148 CCTGAGATGGGGAGTGTTCAGGG + Intronic
1172809456 20:37636968-37636990 CCTCATATTGGCAGGGTGTAGGG + Intergenic
1173614062 20:44391218-44391240 CCTCAGGTGGTGCGGGTGGCAGG - Intronic
1174061413 20:47835596-47835618 ACGCAGATGGTGAGGGGGGAAGG - Intergenic
1174070113 20:47893727-47893749 ACGCAGATGGTGAGGGGGGACGG + Intergenic
1174101207 20:48127450-48127472 ACGCAGATGGTGAGGGGGGAGGG - Intergenic
1174156280 20:48517498-48517520 ACGCAGATGGTGAGGGGGGACGG - Intergenic
1174516853 20:51099138-51099160 CTGCAGAAGGGGAGGGAGGAGGG + Intergenic
1174648028 20:52103005-52103027 CCTCTGATGGGGAGGTGTGAGGG + Intronic
1174842371 20:53912213-53912235 CCTCGGTTGGGGAGGGTGTGGGG + Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175809141 20:61848210-61848232 GCTCAGGTGGGGAGTGTGGGAGG - Intronic
1177447582 21:21217783-21217805 ATGCAGAAGGGGAGGGTGGAGGG + Intronic
1178974271 21:37208427-37208449 CCCCAGTGGGGGAGGGAGGAGGG - Intergenic
1179016002 21:37594960-37594982 CTTCAGATGGGGAGGGCGGGGGG - Intergenic
1179726951 21:43346154-43346176 CCTGAGTTGGGCGGGGTGGAGGG + Intergenic
1180720791 22:17906833-17906855 CCCCAGAGGGGGAGGTGGGATGG + Exonic
1181343426 22:22200460-22200482 CCACAGGCGGGGCGGGTGGAAGG - Intergenic
1181510129 22:23385348-23385370 CCACAGCAGGGGAGGGTGGGAGG - Intergenic
1182112924 22:27735980-27736002 CCAAAGATGGGGAGGGCAGAGGG + Intergenic
1183107140 22:35622721-35622743 CCAAGGCTGGGGAGGGTGGAGGG - Intronic
1183319098 22:37154261-37154283 CCTCAGATGGAGAGGCAGGGAGG + Intronic
1184027706 22:41870254-41870276 GCAGAGATGGGTAGGGTGGATGG - Intronic
1184224472 22:43121303-43121325 ACTCAGATGGGGAGGTTGGCAGG + Intronic
1184423370 22:44394900-44394922 CCTGAGTGGGGAAGGGTGGAGGG + Intergenic
1184502015 22:44880064-44880086 TCTGAGATGGGGAGGTGGGAGGG + Intergenic
1184582512 22:45426998-45427020 CCAGAGATGGGGAAGGTGGTGGG + Intronic
1184648739 22:45910050-45910072 CCTCAGCTGGGGGTGGTGGCCGG - Intergenic
1184650022 22:45915391-45915413 CCACAGGTGGGTGGGGTGGAGGG + Intergenic
1185329580 22:50246146-50246168 CCTGAGATTGGGAGGTTGGGAGG - Intronic
950023694 3:9806651-9806673 CCCCAGGTGGGGAGGGAGGGAGG + Intronic
950464959 3:13148267-13148289 CCTCACAGAGGGAGGGAGGAGGG + Intergenic
952132862 3:30384808-30384830 CTTGAGATGAGGAGGGAGGAGGG - Intergenic
954427222 3:50449789-50449811 TCTCTGATGGGGAGTGTGGTGGG - Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954820075 3:53318428-53318450 TGACAGATGGGGATGGTGGAGGG + Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
955941542 3:64150811-64150833 GCTCAGTTTGGGAGAGTGGAGGG + Intronic
955963966 3:64368978-64369000 TATCAGCTGGGGAGGGTGGCAGG + Intronic
955972373 3:64448020-64448042 CCTCAGATATGGCTGGTGGAGGG + Intergenic
956335823 3:68162276-68162298 CCACAGATGGGGTTGGGGGATGG + Intronic
957094727 3:75768174-75768196 CTTTAGATGGGGTTGGTGGAAGG - Intronic
958812259 3:98874781-98874803 CCTCACATGACGAGGTTGGAGGG - Intronic
959631307 3:108510236-108510258 CCACAGAAGAGGAGGGTGGCTGG - Intronic
960862272 3:122165125-122165147 CCTCAGACGGGGCGGCTGGCCGG - Intergenic
960937373 3:122912229-122912251 CCTCACCTGGGGAGGGTGCGGGG + Exonic
961110022 3:124276026-124276048 TCTCAGATGTAGAGGGTGCATGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961306410 3:125961067-125961089 CCACAGATGGGGGGCGTAGAAGG - Intergenic
961483543 3:127199891-127199913 CCTCAGCTGGGGAGGGGAGAGGG + Intergenic
962075076 3:132073021-132073043 CCTGTCATGGGGTGGGTGGAGGG + Intronic
962153621 3:132919885-132919907 ACTCGGAAGGGGAGGGTGGGAGG + Intergenic
962155118 3:132938271-132938293 CCACTGATTGAGAGGGTGGATGG + Intergenic
962685564 3:137844557-137844579 GCTGTGATAGGGAGGGTGGATGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
963605637 3:147410054-147410076 CCTCGGCTGGCGAGGGTGGGGGG + Exonic
963990559 3:151648622-151648644 CCTTAGGTGGGGAGGGTGTGAGG - Intergenic
964330687 3:155599012-155599034 CTTCATATGGGGAGGGGGGCGGG - Intronic
964560334 3:157988261-157988283 CCTGTCATGGGGTGGGTGGAGGG + Intergenic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
967136168 3:186514721-186514743 CCACAGAAGGGGTGGGTGGAAGG - Intergenic
969599847 4:8169872-8169894 CCTGAGATGGGGTGTGTGGAAGG - Intergenic
969837765 4:9857474-9857496 CCTGAGATGGTGAGGGAAGATGG - Intronic
969925942 4:10585931-10585953 CCACAGATGGGGGTGGGGGATGG + Intronic
974507247 4:62791578-62791600 CCTCATCTGGGGTGGGTTGAGGG - Intergenic
975235235 4:71987090-71987112 CCTCTTGTGGGGTGGGTGGAGGG + Intergenic
976615160 4:87068984-87069006 GTTCAGGTGGGGAGGATGGAGGG + Intronic
977581369 4:98728713-98728735 CAGCAGATGGGGTGGGAGGAAGG + Intergenic
977591420 4:98831863-98831885 CCTCACATGGGGAGGGTTGTGGG - Intergenic
977697291 4:99981044-99981066 CCGCAGGTGGGGTGTGTGGATGG + Intergenic
979171623 4:117607694-117607716 CCTGTCATGGGGTGGGTGGAGGG - Intergenic
979661515 4:123261082-123261104 CCACAAATGGGGTGGGGGGATGG - Intronic
982636707 4:157905813-157905835 GCTCAGCTGGGAAGGGAGGAAGG + Intergenic
983145921 4:164214942-164214964 CCTCAGATGGGCAGGCTGTGGGG + Intronic
984712662 4:182898617-182898639 CCTCAGAGATGGAGGGAGGAAGG - Intronic
985047635 4:185956414-185956436 AATCAGATGGGGAGGGTCCAAGG - Exonic
986171314 5:5317040-5317062 CCTCAAATGGTCTGGGTGGAGGG + Intronic
986333335 5:6734304-6734326 CCTCAGAGGGCGAGGGTTGGGGG - Intronic
986685234 5:10270577-10270599 CCTCAGTGGGGGAGGGGAGAGGG + Intergenic
987295006 5:16542166-16542188 CCTGAGATGAGGAGGGTGAGTGG - Intronic
987465557 5:18268009-18268031 CCTAAGTTGGGGGGTGTGGAAGG - Intergenic
989682993 5:44051469-44051491 CCTTAGCTGGGCAGGGTGGCAGG - Intergenic
989987957 5:50724850-50724872 ACTCAGAGTGGGAGGGAGGAAGG - Intronic
990165844 5:52992357-52992379 ACTCAGAAGGGGAGGCTGGCTGG - Intronic
992078868 5:73215988-73216010 CCTTAGATGGGGCGGGGGGGGGG + Intergenic
992967648 5:82019699-82019721 CTACAGATGGGGAGGGAGGGAGG + Intronic
993170968 5:84418732-84418754 CCTGTCATGGGGAGGGGGGAAGG - Intergenic
993284437 5:85973351-85973373 CCTCACATGGGGAGGGGTGGCGG - Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993996251 5:94727110-94727132 GCTCAGATGGGGAGAAGGGATGG - Intronic
997208936 5:132066502-132066524 CCTGAGGAGGGGTGGGTGGAGGG + Intergenic
997264435 5:132486901-132486923 CCTCAGGGAGGGAGGGTAGAAGG - Intronic
997466322 5:134090388-134090410 CCCCAGATGGGAAGGGTGCGTGG + Intergenic
998104809 5:139461770-139461792 GCTCAGATGGGGAGGGGTGGTGG - Intronic
998135562 5:139672608-139672630 CCTGAGGTCTGGAGGGTGGAGGG + Intronic
999366125 5:151024613-151024635 CAGCAGCTGGGGAGGGAGGAAGG + Intronic
999389971 5:151182787-151182809 CCTCAGCTGGGGAGGCTGCCTGG + Exonic
999467912 5:151824324-151824346 ACTCAGATGGGTTGGGTGGTGGG - Intronic
999651334 5:153770447-153770469 CCTGAGATAGGGAGGGGAGAGGG - Intronic
1000346228 5:160316328-160316350 CTTCAGAGGTTGAGGGTGGAGGG - Intronic
1001828486 5:174765894-174765916 GCTCAGATAGGGAAGGAGGATGG - Intergenic
1002001830 5:176200407-176200429 CCTCATGGGGGGAGTGTGGAGGG + Intergenic
1002082457 5:176745645-176745667 CCTCAGGTGGGCGGGGTGGGGGG - Intergenic
1002306843 5:178288529-178288551 CCTCAGAGGGCCAGGCTGGAGGG + Intronic
1002461428 5:179375842-179375864 GCTCAGCAGGGGAGGGGGGAAGG + Intergenic
1002466605 5:179411884-179411906 CCGGTGGTGGGGAGGGTGGAAGG - Intergenic
1002523443 5:179803631-179803653 CCTCAGATGGACAGGCTGGGTGG + Intronic
1002833152 6:842394-842416 CTTCAGATCGGGAGGCCGGAGGG - Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003133321 6:3413916-3413938 CCTCAGATGGGCAAGATTGAGGG - Intronic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003620115 6:7692027-7692049 CCTCAGGTGTGGAGTGTGAAGGG + Intergenic
1004801154 6:19149551-19149573 AGTCAGATGGGTAGGGTGGCAGG - Intergenic
1006408904 6:33860765-33860787 ACTCTGCTGGGCAGGGTGGAAGG - Intergenic
1006471946 6:34234803-34234825 CCTGAGACGGGGAGGGGAGAGGG - Intergenic
1007945320 6:45821307-45821329 CCTGAGAAGGGCAGGGAGGATGG + Intergenic
1008857763 6:56112505-56112527 CCTCTGCTGGGGAAGGGGGAGGG - Intronic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1008966025 6:57313633-57313655 AGTGAAATGGGGAGGGTGGAGGG + Intergenic
1009940122 6:70281125-70281147 TCACAGATGGGGATGGTGTAAGG + Intronic
1010544688 6:77137848-77137870 ACTGACATGGGGAGAGTGGATGG - Intergenic
1013286688 6:108688033-108688055 CCTCAGTAGGGGAGGAGGGAGGG + Intergenic
1014168703 6:118254034-118254056 CAGCAGATGGGGAGAGGGGACGG + Intronic
1014408445 6:121082479-121082501 CCTAAGATGGGGAGGGATTATGG + Intronic
1014493809 6:122094314-122094336 CCTCAGAAAGGGGAGGTGGAGGG + Intergenic
1016295781 6:142572527-142572549 CCTAAGATGGAGAGGGTTAAAGG + Intergenic
1017071164 6:150576539-150576561 CCTCAGGTGGTGAGGGGGGTTGG + Intergenic
1017604406 6:156118441-156118463 ATTCAGGTGGGAAGGGTGGAGGG - Intergenic
1019411025 7:906817-906839 GGTCAGATGGTGATGGTGGATGG + Intronic
1019465429 7:1185600-1185622 CCACGGAGGGGGAGGGTGGACGG - Intergenic
1019594199 7:1850853-1850875 CCTGGGATGGGGAGTGGGGAGGG + Intronic
1019667603 7:2259570-2259592 CCTGAGGTCTGGAGGGTGGAAGG - Intronic
1019737176 7:2656347-2656369 CCAGAGACAGGGAGGGTGGAGGG - Intronic
1019757469 7:2783446-2783468 CCTCAGAGGGTGAGGATGAATGG - Intronic
1020007419 7:4789994-4790016 CCACTGAAGGGGAGGGGGGAGGG - Intronic
1020529132 7:9307378-9307400 CCTGAGATGGGGAGAGTAGTGGG - Intergenic
1021461176 7:20888734-20888756 CCACAGATGGGGGTGGAGGAGGG - Intergenic
1021715459 7:23458033-23458055 ATTCAGATGGGGAAGCTGGATGG - Intronic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1021976409 7:26015024-26015046 CCTTAAGTGGGGAGGGTGGGAGG - Intergenic
1022567252 7:31415864-31415886 CCTGAGAAGGGCAGGGTGGAGGG - Intergenic
1023025020 7:36042335-36042357 CCTGAGATGGTGAGGGGTGATGG + Intergenic
1023821895 7:43985310-43985332 CCTGAGGTGTGGAGGGTGGAGGG - Intergenic
1023912028 7:44563099-44563121 GCTGAGATGGGAAGGGTGGGAGG - Intergenic
1024247297 7:47479977-47479999 GCTCAGATGGGCAGGGGGCAAGG + Intronic
1026664434 7:72330215-72330237 CCTCAGAGGTGGAGGGTGCAGGG + Intronic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1026956144 7:74377467-74377489 CCTCAGAGGGGCTGGGAGGATGG - Intronic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1029270228 7:99373205-99373227 CCTCCAATGGGGAGGGTGTCGGG + Intronic
1029750160 7:102538732-102538754 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1029768111 7:102637840-102637862 CCTGAGGTGTGGAGGGTGGAGGG - Intronic
1030352085 7:108500955-108500977 CCTCAGATGGTGGCAGTGGAAGG - Intronic
1030921658 7:115397103-115397125 ACCCAGAAGGGGAGGGTGGAAGG - Intergenic
1032063725 7:128747555-128747577 GCTCAGTGGGGGAGGGTGGGAGG - Exonic
1033299235 7:140172063-140172085 CCTTAGATTGGGAGGATGCAGGG + Intronic
1034463663 7:151212905-151212927 GCTCAGGTGGCTAGGGTGGATGG - Intronic
1034469974 7:151249787-151249809 CCCCAGAAGGGGCGTGTGGAAGG + Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035110598 7:156478610-156478632 CGGCAGCTGGGGAGGGTGGCTGG - Intergenic
1035569598 8:663252-663274 GCTCAGATGGGCAGCATGGAGGG - Intronic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037727295 8:21493495-21493517 TCTCAGCAGGGAAGGGTGGATGG - Intergenic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1041260880 8:56019602-56019624 CCTCAGGTGGGGCCGGTGGATGG + Intergenic
1045358695 8:101412432-101412454 CCTGATATGGGGAGACTGGAAGG - Intergenic
1046744274 8:117860346-117860368 CCTCAAGGTGGGAGGGTGGAAGG + Intronic
1047416204 8:124666697-124666719 CATGGGATAGGGAGGGTGGAGGG + Intronic
1047559925 8:125975797-125975819 CCACAGATGGGGATGGGGGATGG + Intergenic
1048261079 8:132945544-132945566 GCTCAGAAGGGAAGTGTGGATGG + Intronic
1048314812 8:133354077-133354099 CCTCTTATGGGGTGGGGGGAAGG - Intergenic
1048886749 8:138915119-138915141 CCTGACATGGTGAGGGTGGTGGG - Intergenic
1049243030 8:141548384-141548406 CCCCAGAGAGGGAGGGAGGAAGG + Intergenic
1049426562 8:142540522-142540544 CCTCAGAGCGGGAGGGTGGGCGG + Intronic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1050874051 9:10613203-10613225 CGCCAGATGGGGCGGGAGGAGGG + Intergenic
1051047071 9:12888183-12888205 CCTCTGCTGGGGATGGTGTAGGG - Intergenic
1051173746 9:14344404-14344426 TCTCAGAAGGGGGGGGTAGAGGG + Intronic
1051896097 9:21990401-21990423 CCTTAGATGGGTAGGGAGGGAGG - Intronic
1052070993 9:24081171-24081193 CCTCTGCTAGGGAAGGTGGAAGG + Intergenic
1052817434 9:33112312-33112334 CCCCAGGTGGGCAGGGCGGAGGG - Exonic
1055018063 9:71640405-71640427 CCTGAGAAGGGGAGAGTGGGTGG - Intergenic
1055481451 9:76712476-76712498 GCTAGGATGGGGAGGGTGGGTGG + Intronic
1056100977 9:83300538-83300560 ACTCAGAAGGGGAGGGTAGTAGG + Intronic
1056287679 9:85107865-85107887 ACTCATATGGGCAGGGTGGAGGG + Intergenic
1056667159 9:88589989-88590011 CCTCAGATGGGCACAGTGGGTGG - Intergenic
1056825807 9:89875655-89875677 CCACAGATGGGGGCGGTGCATGG - Intergenic
1057227709 9:93301353-93301375 CCTCTGATGGGGTGGGTGGATGG - Intronic
1058002649 9:99881871-99881893 CCTCAGCTGGGAAGGCTTGAAGG + Intergenic
1058122552 9:101154954-101154976 CCTCTCATGGGGTGGGGGGAGGG + Intronic
1058530517 9:105901245-105901267 CCTCAGAAGAGGAGGGTAGGGGG + Intergenic
1058824984 9:108767306-108767328 CCACTGATGGGCAGGGGGGATGG - Intergenic
1059034418 9:110738673-110738695 CCCCAGAAGGGGTGGGTGGGAGG + Intronic
1059211725 9:112518562-112518584 TGTGAGATTGGGAGGGTGGAAGG + Intronic
1060070306 9:120541220-120541242 ACTCTGGTGGGCAGGGTGGAGGG - Intronic
1060237574 9:121876686-121876708 ACTGAGAGGGGAAGGGTGGATGG + Intronic
1060750063 9:126163032-126163054 CCTCAGCTGTGGAGGGTGCTGGG + Intergenic
1060785734 9:126450502-126450524 CCTCACATGGGGATGGAGCAGGG - Intronic
1061028901 9:128068089-128068111 GCTCGGATGGGGAGGAGGGAGGG - Intronic
1061232145 9:129321265-129321287 CCTCAGCTGGGCGGGGAGGAGGG - Intergenic
1061637469 9:131922016-131922038 CCTGTCATGGGGAGGGGGGAGGG + Intronic
1062073443 9:134571755-134571777 CCACAGAAGTGGAGGTTGGAGGG - Intergenic
1185616033 X:1422585-1422607 CCACAGAATGGGAGGCTGGAAGG + Intronic
1185690963 X:2154949-2154971 CCTCAGAGAGGGAGGATGTAAGG + Intergenic
1185932025 X:4213891-4213913 CCAAAGATGGGAAGAGTGGAAGG - Intergenic
1187075439 X:15929902-15929924 CGTCAGCTGGGGTGGCTGGAAGG + Intergenic
1187568766 X:20479030-20479052 ACTCAGAAGGGAAGGGTGGGAGG + Intergenic
1188784232 X:34324467-34324489 CCTCAGGAGGGAAGGTTGGAAGG + Intergenic
1189487213 X:41442977-41442999 CCTCAGATCAGGATGGGGGAGGG - Intergenic
1189526031 X:41823027-41823049 CCTCAGCGGGGGTGGGGGGAGGG + Intronic
1190126455 X:47709686-47709708 CATCAGTGGGGGTGGGTGGATGG + Intergenic
1192025914 X:67451253-67451275 CCTGTGCTGGGGAGGCTGGAGGG + Intergenic
1192133535 X:68575304-68575326 GCTGAGATGGGGAGGGCAGAGGG + Intergenic
1194401812 X:93446717-93446739 CCTCAGAAGGGAAGGGGAGAGGG - Intergenic
1194611611 X:96051280-96051302 TCTCAGATGGGGAGGTTGCCAGG + Intergenic
1194793760 X:98184205-98184227 CCTCAGGTGGGGTGGGGGGTGGG - Intergenic
1195571621 X:106403399-106403421 CCTGAGATAGGAAGGATGGAAGG - Intergenic
1196155760 X:112427921-112427943 ACTCAGAGGGGAAGGGTGGGAGG - Intergenic
1197374844 X:125670166-125670188 TCTAAGATGGGGTGGGAGGAGGG - Intergenic
1198039571 X:132836439-132836461 CCACAAATGGGAAGGCTGGAAGG + Intronic
1198379208 X:136068397-136068419 TCTCAGTTGGGGAGGTTGGGGGG + Intergenic
1198413503 X:136395384-136395406 CTACAGATGGGCTGGGTGGATGG + Exonic
1198659615 X:138953421-138953443 CCTGTGGTGGGGTGGGTGGAGGG + Intronic
1198725268 X:139670460-139670482 CCTGTGGTGGGGTGGGTGGAGGG - Intronic
1198805152 X:140486843-140486865 GTTCATTTGGGGAGGGTGGAAGG - Intergenic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic
1200397380 X:155999137-155999159 CCTGTGATGGGGAGGGAAGATGG + Intronic
1201597585 Y:15689043-15689065 CCTCATTTGGGGAGGGCAGAGGG - Intergenic