ID: 962754455

View in Genome Browser
Species Human (GRCh38)
Location 3:138457354-138457376
Sequence CTGTGTGAGTAGGGGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 498}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962754447_962754455 3 Left 962754447 3:138457328-138457350 CCTGGCCTCAGGGCCACTCTGTG 0: 1
1: 0
2: 3
3: 62
4: 375
Right 962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG 0: 1
1: 0
2: 6
3: 55
4: 498
962754450_962754455 -10 Left 962754450 3:138457341-138457363 CCACTCTGTGTGGCTGTGTGAGT 0: 1
1: 0
2: 7
3: 129
4: 1536
Right 962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG 0: 1
1: 0
2: 6
3: 55
4: 498
962754449_962754455 -2 Left 962754449 3:138457333-138457355 CCTCAGGGCCACTCTGTGTGGCT 0: 1
1: 0
2: 1
3: 40
4: 296
Right 962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG 0: 1
1: 0
2: 6
3: 55
4: 498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962754455 Original CRISPR CTGTGTGAGTAGGGGCAGGA AGG Intronic
900799912 1:4730898-4730920 CTTTGTGATTAGGGGAAAGAAGG - Intronic
900996134 1:6124611-6124633 CTGTGTGAGCCGGGGGCGGATGG - Exonic
901573417 1:10180385-10180407 CAGTGCAAGTAGGGTCAGGAAGG - Exonic
902382116 1:16057669-16057691 CTGTGTGAGCATTGGCAGTAGGG + Intergenic
902697283 1:18148895-18148917 TTGTGTGTGCAGGGGCAGGAGGG - Intronic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903174846 1:21574774-21574796 CTTTGTGAGCAAGGCCAGGATGG + Intronic
903190064 1:21651367-21651389 ATGTGGGAGTAGGGGCAGGCAGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903302725 1:22390705-22390727 GTGTGTGTGTTGGGGCAGGAAGG - Intergenic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG + Intronic
904444704 1:30559632-30559654 CTGAGTGAGATGGAGCAGGATGG + Intergenic
904825290 1:33270306-33270328 CTGTGTGATTTGGGGCAAGTTGG + Intronic
906146164 1:43561913-43561935 CTGTGAGTATAGGGGCAGGGGGG - Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906948616 1:50316593-50316615 CTTTCTGAGGAGGGGCAGAAAGG + Intergenic
907454678 1:54567716-54567738 GTGTGTGAGAAGGGACAGGGTGG - Intronic
907581586 1:55577197-55577219 CTGGGTGATAAGCGGCAGGATGG - Intergenic
907763761 1:57388292-57388314 CTGGGTGAATAGGGGCTGCAGGG - Intronic
908515147 1:64884640-64884662 CAGTGTGAGTGAAGGCAGGAGGG - Intronic
909732715 1:78914756-78914778 GTGTTTGAGTAGGGGCAGAGTGG + Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
911397888 1:97334972-97334994 CTGTGTGTGTTGGGGCAGTGGGG + Intronic
911437901 1:97886393-97886415 CTCTATGAGTGGGGGCTGGATGG - Intronic
913387973 1:118280230-118280252 CTGTGAGAGTAAGGGCACGCAGG - Intergenic
915341119 1:155177325-155177347 GCCTGGGAGTAGGGGCAGGAAGG + Intronic
915593456 1:156883427-156883449 CTCTGTGGGTAGAGACAGGAGGG + Intergenic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916695516 1:167231993-167232015 GTGTGTGTGTTGGGGGAGGAGGG - Intronic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
917776724 1:178345073-178345095 CGGTTTGAGTAGGGGCAAGGAGG - Intronic
918260093 1:182787914-182787936 GTGTGTGTGAAGAGGCAGGAGGG - Intergenic
918919859 1:190694467-190694489 GTGTGGGAGAAGGGGCAGGGAGG + Intergenic
919012438 1:191983035-191983057 CTGTGATAGTAGTGGTAGGATGG + Intergenic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920240959 1:204550077-204550099 CTGTCTGAAGAGGGGCAGAAGGG - Exonic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920349905 1:205331072-205331094 GTGTGTGTGTTGGGGCAGGCAGG + Intergenic
920495924 1:206454855-206454877 CTGGGGGAGAAGGGGCAGGCAGG - Intronic
920723234 1:208409690-208409712 GAGTGTGAGGAGGTGCAGGAGGG + Intergenic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922680790 1:227593558-227593580 CAGTCTGAGGAGGGTCAGGAGGG + Intronic
922690136 1:227682546-227682568 CAGTCTGAGGAGGGTCAGGAGGG - Intergenic
922844056 1:228668972-228668994 CTGAATGAAAAGGGGCAGGATGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
924273889 1:242365216-242365238 CTGTATGAGGTGGTGCAGGAAGG + Intronic
924700737 1:246449463-246449485 CAGTGTGATATGGGGCAGGAGGG + Intronic
924895710 1:248336237-248336259 CAGTGGGATTAGGGGCAGCATGG + Intergenic
1062799088 10:366437-366459 CAGTGTGAGAGGGGGCAGGTGGG + Intronic
1062901054 10:1147446-1147468 CGGTGTGTGTAGGGGGAGGAGGG + Intergenic
1064538265 10:16380140-16380162 CTGTGAGACTTGGGGCAGGTGGG - Intergenic
1064640795 10:17414066-17414088 GGGTGTGAGTTGGGGAAGGAGGG - Intronic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1065930989 10:30479013-30479035 CAGTGTGAGGAGAGTCAGGAGGG - Intergenic
1066710824 10:38231460-38231482 CTGTATGAGGTGGTGCAGGAAGG - Intergenic
1067692139 10:48508718-48508740 CTGTGTGAGGAAGGGCCTGAGGG + Intronic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1069631847 10:69902027-69902049 GTGTGTGAGAAGGGCTAGGAGGG + Intronic
1069720120 10:70544503-70544525 CTGAGTGAGGAGGGGCTGCAGGG + Intronic
1070282464 10:75059671-75059693 CAGTGTGAGGAGGGGCAGGCCGG + Intergenic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070780964 10:79137435-79137457 CCGGGTGAGTAGGAGCAGCAGGG - Intronic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1071575927 10:86726278-86726300 CTTTCTGAGAAGAGGCAGGAGGG + Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1071829338 10:89356210-89356232 TGGGGTGAGTAGGGGGAGGAAGG + Intronic
1072424707 10:95320291-95320313 ATGTGTGAGCAGGGGCAGGAAGG - Intronic
1072724268 10:97801790-97801812 CTGGGTGAGAAGGGGGAGGATGG + Intergenic
1073419829 10:103415635-103415657 CTGTGTGACTCTGGGCAAGACGG - Intronic
1073868208 10:107829777-107829799 CTGTGTGTGTCGGGGCGGGGAGG + Intergenic
1075569534 10:123529674-123529696 CTGCCTGGGTAGGGGCAGGGGGG - Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076402549 10:130193520-130193542 CTGTGGGTGAAAGGGCAGGAGGG - Intergenic
1076720344 10:132389655-132389677 CTGAGGGAGGAGGTGCAGGAAGG - Intergenic
1076858310 10:133128035-133128057 CTGGGTGGGCAGGGGCAGGAAGG - Intronic
1077082928 11:733316-733338 CTGTGTGTGTCGGGGAAGAATGG - Intergenic
1077315105 11:1916163-1916185 CTGGGAGAGGAGGGACAGGAGGG - Intergenic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077640784 11:3879585-3879607 CTCTGTGAGGTGGGACAGGAGGG + Intronic
1078180420 11:9005665-9005687 CTGTGGGGGTAGGGGTAGGGGGG + Intergenic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1080479966 11:32637585-32637607 GTGTGTGTTTGGGGGCAGGAGGG - Intronic
1080758588 11:35226118-35226140 CTGTCTGAGTAGTTTCAGGAGGG - Intronic
1081010608 11:37806674-37806696 CTATGTGTGTTGGGGAAGGAGGG + Intergenic
1081517947 11:43851843-43851865 ATGTGTGAAGAGTGGCAGGAGGG - Intronic
1081651468 11:44826941-44826963 TTATGTGATTGGGGGCAGGAGGG + Intronic
1081671990 11:44947563-44947585 CTGGGTGAGTTGGGGGAGGCAGG + Intronic
1082065906 11:47900085-47900107 CTGGGTGAGTAGAGGCTGGGTGG + Intergenic
1083256418 11:61498810-61498832 CGGTGTGAGGAGCGGCAGCAGGG - Intergenic
1083309225 11:61775979-61776001 CTGGCTGAGAGGGGGCAGGAGGG + Intronic
1083742317 11:64717431-64717453 ATCTGTGGGTAGGGGCAGGGTGG - Intronic
1083887741 11:65581081-65581103 CTTTGTGAGGAGGAGGAGGAAGG + Exonic
1083904055 11:65658717-65658739 CTGTGTGACAAGGTGCAGAAAGG - Exonic
1083944236 11:65915312-65915334 CTGGGTGAGCATGGGCAGAAAGG + Intergenic
1084162709 11:67358646-67358668 CTGAGTGAGTAGGGGGCGGGTGG - Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084665376 11:70573534-70573556 CTGTGTGTGTGGGGGCGGGGGGG + Intronic
1084790497 11:71472720-71472742 CAGTGTGAGTGGGGGAAGGGAGG - Intronic
1085345355 11:75765085-75765107 CTGTGTGAGTTTGGGCAAGGGGG - Intronic
1085346456 11:75771181-75771203 CTGTGGGAGTATGGGTAGGTGGG + Intronic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087684501 11:101248109-101248131 CAGTCTGAGTAGAGTCAGGAGGG - Intergenic
1088217078 11:107522952-107522974 CTGTGTGAGAGGGGGCCCGAAGG - Intronic
1088326896 11:108609917-108609939 CTGTGTGGGATGGAGCAGGATGG + Intergenic
1088849829 11:113695594-113695616 GTGTTTGGGTGGGGGCAGGAAGG - Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090406482 11:126478829-126478851 CTGCGTGAGTAGTGGGAGGGAGG + Intronic
1090671197 11:128946686-128946708 CCATTTGAGTAGGGGCAGGGAGG + Intergenic
1090785177 11:130042338-130042360 CTCTCTGAGTAGGGACAGAAAGG + Intergenic
1090868565 11:130723345-130723367 CTGTGTGGGAAGGGCCACGATGG + Intergenic
1090901247 11:131033565-131033587 CTGAGTCAGCAGGGGAAGGATGG + Intergenic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092171426 12:6375948-6375970 CTGAGTGAGTAGAGGCAGGTGGG + Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1095162369 12:38933279-38933301 CAGTCTGAGTAGAGCCAGGAAGG + Intergenic
1095545504 12:43363346-43363368 CTCTGTGAGTAGGGACTGGGTGG - Intronic
1095969434 12:47891731-47891753 CTGGATGAGAAGGGACAGGAAGG - Intronic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1097008895 12:55938615-55938637 CTGGAAGAGTTGGGGCAGGAGGG - Intronic
1097196226 12:57243698-57243720 CTGGGAGAGGAGGGGTAGGAAGG - Exonic
1097289509 12:57902585-57902607 CTGTGTAAGTAGGAGCAATAGGG + Intergenic
1097721449 12:63025948-63025970 TTGGGTGTGTAGGGGCAGAAAGG + Intergenic
1097866174 12:64560847-64560869 CTGTGAGAGACGGGGAAGGAAGG + Intergenic
1099719673 12:86344766-86344788 GTGTGTGTGTAGCGGCAAGAGGG + Intronic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1099930802 12:89072182-89072204 GTGCGTTAGTAGTGGCAGGAGGG + Intergenic
1100025344 12:90121740-90121762 CTGTGACAGTAGTGGCAGGTTGG + Intergenic
1100741821 12:97602254-97602276 ATGTGTGCGTCGGGGCAGGGGGG + Intergenic
1101824412 12:108209547-108209569 CTATGTGAGTAGGTGTAGAAGGG + Intronic
1102447004 12:113010905-113010927 CTGTGTCAGCAGGGGCAGAAAGG - Exonic
1103913522 12:124364463-124364485 CTTTGTGTGGAGGGGCAGGTAGG + Intronic
1104163751 12:126206050-126206072 CTGTGAGAGAAGGGGTATGATGG + Intergenic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1107396426 13:40022831-40022853 CTGTGGGTCTAGGGCCAGGATGG + Intergenic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1108500518 13:51066017-51066039 CTGAGTGACTAGGGGCTGGCAGG - Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1113729023 13:112626404-112626426 CTGTGTGACTAGCAGGAGGAGGG - Intergenic
1113878444 13:113608886-113608908 CTGGGAGAGAAAGGGCAGGAGGG - Intronic
1115127226 14:30010512-30010534 CTTGGGGAGCAGGGGCAGGAGGG + Intronic
1116436899 14:44905578-44905600 CTGGGAGAGCATGGGCAGGAGGG - Exonic
1117195450 14:53335813-53335835 CTGTGTGTGTAGGGGCCAGGTGG + Intergenic
1117460404 14:55939443-55939465 CTGTCTGTGTCGGGGGAGGAGGG + Intergenic
1118004725 14:61555041-61555063 GTATGTCAGTTGGGGCAGGATGG - Intronic
1118262114 14:64257416-64257438 CTGTGTGTGTAGAGACAGAATGG + Intronic
1118328243 14:64795952-64795974 CTGTTGGATTTGGGGCAGGAAGG + Intronic
1118730806 14:68664999-68665021 TTATGTGAGTAGGGGAAGAAAGG - Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1118847097 14:69555644-69555666 CAGGGTGAGATGGGGCAGGAGGG + Intergenic
1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG + Intergenic
1119871975 14:78025829-78025851 GTGTGTGTGTTGGGGGAGGAGGG + Intergenic
1120516815 14:85480826-85480848 CTTTGAGATGAGGGGCAGGATGG + Intergenic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121455852 14:94038551-94038573 ATGTGTGAGCAGGGGCGGGAGGG - Intronic
1121730317 14:96182229-96182251 CAGTGTGAGAAGGGGCAGTCAGG - Intergenic
1122006220 14:98705991-98706013 CTGTGTGTGCAGGGCCAGGGTGG - Intergenic
1122235195 14:100327367-100327389 CCGCGTGAGTAGGGGCAGCCAGG + Exonic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122817551 14:104321014-104321036 CCGTCTGAGCAGGGTCAGGAGGG + Intergenic
1123105294 14:105838658-105838680 CTGTGTGTGCATGGGCGGGAGGG - Intergenic
1123114822 14:105889933-105889955 GTGTGTAAGTGGTGGCAGGAAGG + Intergenic
1123403160 15:20005486-20005508 AGGTCCGAGTAGGGGCAGGAGGG - Intergenic
1123512499 15:21012140-21012162 AGGTCCGAGTAGGGGCAGGAGGG - Intergenic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1124059537 15:26276823-26276845 AGGTGTGAGTAGACGCAGGAAGG + Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124719723 15:32100804-32100826 CTGTGTGAGTGGTGCCATGAGGG - Intronic
1125362684 15:38880592-38880614 CTGTGTGACTAGGGTGGGGAAGG + Intergenic
1125717576 15:41827931-41827953 GTGTGTGTCCAGGGGCAGGACGG + Intergenic
1127304140 15:57685502-57685524 CTGTGTGTGTCGGGGGAGGGTGG + Intronic
1127898276 15:63321717-63321739 CTGTGTGTGTAGGGGCGAGGGGG + Exonic
1128063139 15:64747772-64747794 CTGTTAGAGCAGGGCCAGGAAGG - Intronic
1128514662 15:68334855-68334877 CTGGGTGAGTGTGGGCAGGCAGG + Intronic
1128765095 15:70246511-70246533 CTGTGGGTGTTGGAGCAGGACGG + Intergenic
1128873673 15:71184368-71184390 CTGTGTGAGATGGGACAGCATGG + Intronic
1129688643 15:77700717-77700739 CTGGGTGAGCAGGGGCGGGTAGG + Intronic
1130287051 15:82564777-82564799 CTGCTTGAGGAGGGGCAGGGTGG + Intronic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1130843839 15:87725983-87726005 CTGTGTGGGTGGGTGCAGGTGGG - Intergenic
1131431458 15:92392535-92392557 GTGTGTAAGGAGGGGCAGGAGGG - Intergenic
1131864739 15:96695618-96695640 CTGTGTGAGTGGGTGTGGGAGGG + Intergenic
1132758420 16:1497129-1497151 CTGTGAGGGTCGGGGCAGGATGG - Intronic
1134196646 16:12164090-12164112 GTGTGTGTGTAGGGGCACAAAGG + Intronic
1134683718 16:16144287-16144309 CTGGGTGAGTCTGGGCAGTAAGG + Intergenic
1134803560 16:17106729-17106751 GGGGGTGAGTAGGGGGAGGATGG + Exonic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1135830570 16:25769229-25769251 CTGTGTGTGTAGGGGTGGGGAGG + Intronic
1137628184 16:49922661-49922683 CTCACTGAGTAGGGGCAGGCTGG + Intergenic
1138064176 16:53923540-53923562 CTGTGCCAGTAGGGGCAGTGGGG + Intronic
1138147334 16:54624517-54624539 CGTGGTGAGTAGGGGCAGGGAGG - Intergenic
1139472212 16:67184347-67184369 CTGTGTGTGTTGGGGAAGGTGGG - Exonic
1139700776 16:68706873-68706895 CTCTATGAGGAGGGGCAGAAGGG + Intronic
1140887639 16:79258883-79258905 CTGTGCGACTAGGGGAGGGAGGG + Intergenic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141380858 16:83575496-83575518 TGGTGTGAGCAGGGGCTGGATGG - Intronic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141683139 16:85555589-85555611 CTGGGTGAGGAGGGGCGGGGTGG - Intergenic
1142200182 16:88757414-88757436 CTGTGAGAGCAGGGGCGGGTGGG + Intronic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1142600318 17:1050661-1050683 CTGAGTGAGTGGGGCCAGGGTGG + Intronic
1142742930 17:1941411-1941433 CTCTCAGAGGAGGGGCAGGAGGG - Intronic
1143003699 17:3812930-3812952 CTGTGTGAGCAGGAGCGAGAGGG + Exonic
1143007316 17:3845723-3845745 GTGAGTGAGGAGGGGCTGGAAGG - Intronic
1143049202 17:4109411-4109433 CTGTGTGACGAGGAGCAGGAAGG + Intronic
1143053368 17:4144350-4144372 CTGTGAGGGTAGGGGCGGGGCGG - Intronic
1143631988 17:8144848-8144870 CTGTGTGTGCAGGGACAGCACGG + Exonic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144322668 17:14145167-14145189 GTGTGTGTGGAGGGGCAGGGAGG + Intronic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1146183516 17:30710959-30710981 ATGTGTGCCTGGGGGCAGGAGGG + Intergenic
1146224799 17:31056257-31056279 GTGTGTGAATAAGGGCAGAAAGG - Intergenic
1146446739 17:32938048-32938070 CTGGGTGAGTAGGATCAGCACGG + Intronic
1146460328 17:33041109-33041131 CTGTGTGGGCAGGAGGAGGAGGG - Intronic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146930831 17:36776731-36776753 CTATGTGGGTAGGGGCAGAGGGG + Intergenic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1147646612 17:42038123-42038145 CTGCCTCAGTAGGGGCAGGAGGG - Intronic
1147684289 17:42277338-42277360 GTGTCTGAGTGGGGGCGGGAGGG - Intergenic
1147746886 17:42700235-42700257 CTGTGTGCTTTGGGGCTGGAAGG - Intergenic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148610153 17:48959749-48959771 CTCTGTGTGTAGGGACAGGCAGG + Intronic
1148610182 17:48959869-48959891 CTCTGTGTGTAGGGACAGGCAGG + Intronic
1148610236 17:48960069-48960091 CTCTGTGTGTAGGGACAGGCGGG + Intronic
1148610276 17:48960229-48960251 CTCTGTGTGTAGGGACAGGCAGG + Intronic
1148610296 17:48960309-48960331 CTCTGTGTGTAGGGACAGGCGGG + Intronic
1148610314 17:48960389-48960411 CTCTGTGTGTAGGGACAGGCAGG + Intronic
1148610323 17:48960429-48960451 CTCTGTGTGTAGGGACAGGCGGG + Intronic
1148712002 17:49688754-49688776 CCGTGTGAGGTGGGTCAGGAGGG + Intergenic
1148778936 17:50110954-50110976 CTGTGTGCTTAGGGGAAGGGTGG - Exonic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1149532761 17:57408583-57408605 CTGGGTGGGTAGGGGCGGGGGGG + Intronic
1149581395 17:57752834-57752856 CAGTGAGAATAGGAGCAGGATGG + Intergenic
1150106285 17:62464805-62464827 CTGTGGGTGGAGGGGCTGGAGGG + Intronic
1150718012 17:67588482-67588504 CTGGGTGGGGTGGGGCAGGACGG - Intronic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151732100 17:75917690-75917712 CCGTGGCAGGAGGGGCAGGAGGG + Intronic
1151758144 17:76086421-76086443 CAGGGTGGGTGGGGGCAGGAGGG - Intronic
1151971163 17:77458192-77458214 CTGAATGAGTGAGGGCAGGAGGG - Intronic
1152035340 17:77868795-77868817 GTGTGTGTGTAGGGGCAGAGTGG + Intergenic
1152371770 17:79892749-79892771 CAGTGTGCGTAGGTGCAGGGTGG + Intergenic
1152643578 17:81458966-81458988 CTAGGTGAGCAGGGCCAGGAAGG + Exonic
1153226327 18:2902820-2902842 TTGTGTGTGAAGGAGCAGGAGGG + Intronic
1155255396 18:23992920-23992942 CTGTGTGTGTAGGTGCTGGAGGG - Intronic
1155532387 18:26780433-26780455 ACGTGTGAGAAGGGGCAGGCTGG - Intergenic
1156055400 18:32997159-32997181 CTCTGTGTGTGGGGGTAGGATGG + Intronic
1156362936 18:36400396-36400418 CTGTGGGGGTAGGGGCAGACAGG - Intronic
1156975402 18:43216083-43216105 GTGTGAGAGAAGGGGCAAGAAGG + Intergenic
1157618719 18:49003180-49003202 CTGTGTGAGGAGGGAAAGGCAGG - Intergenic
1157624256 18:49036728-49036750 GTGTGTGTGTAGAGACAGGAGGG + Intergenic
1158433523 18:57415610-57415632 CAGTGTGAGCAGGGACAGAATGG - Intergenic
1159730659 18:72023135-72023157 ATGTGTGAGTTGGGGGAAGAGGG - Intergenic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161311323 19:3595706-3595728 CTGCGTGAGCTGGGGCTGGAGGG + Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161726368 19:5931575-5931597 CTATGTGAGTGGGGGTGGGAGGG - Intronic
1162975274 19:14204802-14204824 ATGTGTGCCTGGGGGCAGGAGGG - Intronic
1163040275 19:14597010-14597032 AAGTGTGAGTAGGGCCAGGAAGG + Exonic
1163112420 19:15169819-15169841 CTGGCTGGGGAGGGGCAGGATGG + Intronic
1163189579 19:15666747-15666769 CTGGGTGCCTAGGGGCATGAAGG + Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1166100702 19:40569923-40569945 GTGTGTGTGGAGGGGCAGTAGGG - Intronic
1166196181 19:41207330-41207352 GTGTGTGTGGAGGGGCAGCAGGG - Exonic
1166629425 19:44392066-44392088 ATGTGTGAGTAGGGGAGGGAGGG + Intronic
1167689288 19:50975342-50975364 CTGAGGGAGGAGGGGCTGGAGGG + Intergenic
1167977599 19:53242923-53242945 CTGTATGAGTTGGGGCATCACGG + Intronic
925055187 2:851804-851826 GTGTGTGTGTAGGGGCAAGGGGG + Intergenic
925059241 2:878419-878441 GTGTGTGTGTAGGGGCGGGAGGG - Intergenic
925059269 2:878574-878596 GTGTGTGTGTAGGGGCAAGAGGG - Intergenic
925181299 2:1818686-1818708 ATATGTGAGGAAGGGCAGGAGGG + Intronic
925831980 2:7904587-7904609 CTGTGTGAGCAGGGGACAGAGGG - Intergenic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926089400 2:10040713-10040735 TTGGGTCAGTGGGGGCAGGAAGG + Intergenic
927955495 2:27204770-27204792 CTGTGAGTGCAGGGACAGGAAGG - Exonic
927981097 2:27375706-27375728 CTCTGTGAGTCGGGTTAGGAGGG + Exonic
928167425 2:28981355-28981377 CTGTCTGAGCAGGGGCTGGGTGG - Exonic
928638891 2:33277053-33277075 CTCTGTTAGGTGGGGCAGGATGG + Intronic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
929885271 2:45872503-45872525 CTGTGTAAGAATGGGCAGCAAGG + Intronic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930096677 2:47571010-47571032 AGGGGTGAGTAGGGACAGGAGGG + Intergenic
930242380 2:48949288-48949310 CTATGTGAGTTGGAGGAGGATGG - Intergenic
930737500 2:54794471-54794493 CTGAGGGAGTAGGGACAGGACGG + Intronic
931797744 2:65727929-65727951 GTGTGTGTGTGGGGGCAGGGGGG + Intergenic
931976264 2:67647068-67647090 CTGTGTGAGAAGGGGCCTGAAGG + Intergenic
931994789 2:67829595-67829617 CTGTGTGACCTTGGGCAGGAAGG - Intergenic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932493934 2:72137496-72137518 GTGTGTGAGTAGGGGCTGGAAGG - Intronic
932621225 2:73265790-73265812 CAGGGAGGGTAGGGGCAGGAGGG + Intronic
933718004 2:85376343-85376365 CTGTGCCAGCAGGGGAAGGAGGG + Intronic
933981090 2:87551478-87551500 TTGGGTGAGTAGGGGATGGAAGG + Intergenic
933983851 2:87574766-87574788 CTCTGTGAGGATGGGTAGGAGGG - Intergenic
934211959 2:89988067-89988089 CTGTGGGAGTTTGGGTAGGAAGG - Intergenic
935433600 2:103004283-103004305 ATGTGTGACTGGGGGCAGGGTGG + Intergenic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936310003 2:111376028-111376050 CTCTGTGAGGATGGGTAGGAGGG + Intergenic
936399334 2:112153838-112153860 CTGTGCGAGAAGGGGCTGGAGGG + Intronic
937363411 2:121244411-121244433 TTCTGTGAGTGGGGGCAGGCAGG + Intronic
937506627 2:122544838-122544860 TTGTGTGAGTTGGGGAAAGAAGG + Intergenic
937972973 2:127564557-127564579 AGGTGTGTGGAGGGGCAGGACGG + Intronic
938069226 2:128299790-128299812 CTGTGTTAGCAGGGCCGGGATGG - Intronic
938544220 2:132313259-132313281 ATGTGTGATTAGGGGAGGGAGGG - Intergenic
941145685 2:161841363-161841385 CTGTGTCAGCAGGGGCATGGTGG - Intronic
942671635 2:178382189-178382211 TTATCTTAGTAGGGGCAGGAGGG - Intronic
944650889 2:201829242-201829264 CTGTGTGAGTAGGGGGAGAGAGG - Intronic
945424187 2:209679306-209679328 ATCTATGAGTAGGGGCAGCAAGG - Intronic
946178273 2:217935170-217935192 CAGGGTGAGGAGGGGGAGGAAGG + Intronic
946456641 2:219832014-219832036 CAGAGTGTGAAGGGGCAGGAAGG + Intergenic
947319542 2:228900766-228900788 CTGTTTGTGAATGGGCAGGAGGG + Intronic
947498691 2:230657078-230657100 GTGGGTGGGTGGGGGCAGGAGGG + Intergenic
947726940 2:232406975-232406997 GTGTGTGTGTAGGGGCAGCTGGG - Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1169927594 20:10799135-10799157 CTGTGTGTGTTGGGGGAGGGGGG + Intergenic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170506505 20:17031170-17031192 CTGTATGAGTAGGGGTGGGAGGG + Intergenic
1171305536 20:24102646-24102668 CTGTGTGGCCATGGGCAGGATGG - Intergenic
1171873084 20:30545991-30546013 ATGTGTGATTAGGGGAGGGAGGG - Intergenic
1172004117 20:31805891-31805913 ACGTGGGAGTAGGGGAAGGAAGG - Intergenic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1175321424 20:58090854-58090876 CTGAGACAGGAGGGGCAGGAGGG - Intergenic
1177284258 21:19028049-19028071 CTAGGAGAGTAAGGGCAGGAAGG + Intergenic
1178170633 21:30035764-30035786 CTGGGGGGGTAGGGGGAGGAAGG + Intergenic
1178356423 21:31913478-31913500 GTGTGGGAATAGGGGCAGGGTGG + Intronic
1178976594 21:37226249-37226271 CAGTGTGAGGAGGGGTGGGAAGG + Intronic
1179021764 21:37647324-37647346 GTGTATGAGTAGGGTCGGGATGG + Intronic
1179119130 21:38526688-38526710 CTGAGTGAGGAGGGTCAGGAAGG + Intronic
1179344143 21:40540436-40540458 CAGTGTGAGGAGGGGCATGGAGG - Intronic
1179585368 21:42370942-42370964 GTGTGTGAGCAGTGGCTGGAGGG - Intergenic
1183359933 22:37378203-37378225 TTGTGTGTGCAGGGGCAGGAAGG + Intronic
1183590295 22:38775899-38775921 CTGTGGGGGACGGGGCAGGAGGG + Intronic
1183599183 22:38830190-38830212 CCGTGAGAGTAGGGACAGGTGGG + Intronic
1184576758 22:45374839-45374861 CTGTGAAAATAGGGGAAGGAAGG - Intronic
1184685434 22:46094712-46094734 CTGGGTGAGTGGTGGCAGGCAGG + Intronic
1184815815 22:46868923-46868945 CTGTGTGGGTAGGAGTAGGTGGG + Intronic
1185339313 22:50284476-50284498 CTGTGAGGGGAGGGGCAGCAGGG - Intronic
1185348101 22:50319461-50319483 CCGGGTGGGTAGGGGCAGGGGGG - Intronic
949408525 3:3739699-3739721 GTGTGTGTGTTGGGGGAGGAAGG - Intronic
949441782 3:4089155-4089177 CTTTGTGAGTAGGAGCAAAAGGG - Intronic
950528063 3:13536190-13536212 ATGTGGGAGGAGGGGCAGGTGGG - Intergenic
951262294 3:20524088-20524110 CTGTCTGAGTAGGAGCTGCAAGG + Intergenic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953835124 3:46336053-46336075 CTGTCTGAATATGGGCATGAGGG + Intergenic
954221730 3:49158946-49158968 CTCTGTGGCTAGGGGTAGGAGGG + Intergenic
954409325 3:50363532-50363554 GTGTGTGTGTAGGGGTGGGAAGG + Intronic
955607150 3:60717493-60717515 CTGTTTGAGTAGGCCCATGATGG - Intronic
956931224 3:74045648-74045670 CTGTATGAGTAGGGGCAGTATGG + Intergenic
961077820 3:123998105-123998127 CTGTGTGAGGAGAGGCAGAGGGG - Intergenic
961306750 3:125963230-125963252 CTGTGTGAGGAGAGGCAGAGGGG + Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962920942 3:139949940-139949962 ATGTGTGTGTAGAGGCAAGAAGG + Intronic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
964737285 3:159929837-159929859 CTGTGTGGGGAGGGGCCGGCAGG + Intergenic
965200603 3:165653333-165653355 CTGTGAGGGTAGGAGCAAGATGG - Intergenic
966412113 3:179654481-179654503 ATGTGTGAGAAGCAGCAGGAGGG + Intronic
966854997 3:184187758-184187780 CTCTGTGAGTGGGGGAAGCATGG + Exonic
966931350 3:184677790-184677812 CGGTCTGTGGAGGGGCAGGAGGG - Intronic
967130981 3:186470497-186470519 TTGTGTGAGGGAGGGCAGGAGGG + Intergenic
967194876 3:187017468-187017490 CTGTGAGATTAGGGGTGGGAGGG + Intronic
968712578 4:2129870-2129892 CTATGTGGGAAGGGGCAGCAGGG + Intronic
968856238 4:3125890-3125912 CTTTGTGAGTAGGGGATGGCAGG + Intronic
968959796 4:3737703-3737725 GTGTGAGAGGAGGGGCTGGAGGG - Intergenic
969587880 4:8104952-8104974 GGGTGTGAGTGGGAGCAGGAGGG - Intronic
969681475 4:8645639-8645661 CTGTGATATGAGGGGCAGGAAGG - Intergenic
971215947 4:24662266-24662288 CTGTGTGTGTGGGGGCGGGGGGG - Intergenic
971296831 4:25401283-25401305 CTGTGTAGGTTGGGGCAGCAGGG + Intronic
972217038 4:36909186-36909208 CAGTCTGAGGAGAGGCAGGAGGG - Intergenic
975533890 4:75428557-75428579 CTGTGTCCTCAGGGGCAGGAAGG - Intergenic
975787974 4:77913961-77913983 GTGGGTGAAGAGGGGCAGGAAGG + Intronic
976404393 4:84645891-84645913 CTGTGTGTGTAGGGGCTGGCTGG + Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
980075140 4:128287204-128287226 GTGTGTGTGTAGGGGCGGGATGG + Intronic
981491723 4:145346864-145346886 CTGTCTAAGTGGGTGCAGGACGG - Intergenic
984041816 4:174744344-174744366 CTGTGTCAGTAGGACCAGGCAGG - Intronic
984651148 4:182271887-182271909 CTGTGAGAGCAGGTGCAGCAGGG + Intronic
984653338 4:182291869-182291891 CTGTGTGTGTAGGGCTGGGAGGG + Intronic
984944934 4:184963245-184963267 CTTTGTAAATAAGGGCAGGAGGG + Intergenic
985573903 5:664935-664957 CGGTAGGAGGAGGGGCAGGAGGG + Exonic
986285946 5:6359089-6359111 CTTTGTCAGCAGGGGCAGGCTGG - Intergenic
986589824 5:9357033-9357055 CTGTGTGAATGGGCTCAGGAAGG - Intronic
987930556 5:24395004-24395026 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
992013548 5:72554611-72554633 CTGAGTGGGGAGGGGCAGGAAGG - Intergenic
992614122 5:78533460-78533482 CTGTGAGAGTAGGGGATGGGCGG + Intronic
992874748 5:81042928-81042950 CGCTGTGAGGAGGAGCAGGATGG + Exonic
993354755 5:86892235-86892257 TTGTGTGAGAAGGAGAAGGAAGG - Intergenic
993852026 5:93022253-93022275 GGGGGTGGGTAGGGGCAGGAGGG + Intergenic
994558035 5:101330124-101330146 CTGACTGAGAAGGGGCAGTAGGG - Intergenic
995032624 5:107496568-107496590 CTGTGTCAGTGAGAGCAGGAAGG - Intronic
995506279 5:112863550-112863572 GTGTGTGGGTAGGGGTAGGGAGG + Intronic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
997875554 5:137543651-137543673 CTGTGTGTGTAAGGAGAGGAGGG + Intronic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
998153500 5:139770717-139770739 ATGTGTGAGGAGGGGCTGAAAGG - Intergenic
998406822 5:141878732-141878754 GTGTTTGAGTAGGGTAAGGAGGG - Intronic
999071783 5:148750774-148750796 CACTGTGGGTTGGGGCAGGAAGG - Intergenic
999239778 5:150120711-150120733 CTATGTGTGCAGGGACAGGATGG - Intronic
999642904 5:153689758-153689780 CAATGTGAGTAGGGAGAGGATGG - Intronic
1000196000 5:158958504-158958526 CTGACTGAGTAAGGGCAGGGCGG - Intronic
1000367615 5:160505843-160505865 CTGTGTGAGAAGGCACAGGCAGG - Intergenic
1000427693 5:161112030-161112052 CTGTATGAGTAGGGGTAAGAAGG - Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001266263 5:170276605-170276627 CTGGGGGAGCTGGGGCAGGAGGG + Intronic
1001905750 5:175471689-175471711 CTGACTGAGAAAGGGCAGGAGGG + Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002712501 5:181203933-181203955 CTGGGAGAGTTGGAGCAGGATGG + Intronic
1003087703 6:3074179-3074201 CTGAGTGGGCAGGGGCATGAAGG - Intronic
1003135008 6:3428254-3428276 GAGGGTGAGGAGGGGCAGGAAGG - Intronic
1003156692 6:3603139-3603161 CTGTGGGGGTAGTGGCAGGTTGG + Intergenic
1004415221 6:15417146-15417168 GTGGGTGAGTAGGGGGAAGAGGG + Intronic
1004987177 6:21095576-21095598 GTATGTGTGTAGGGGTAGGAGGG - Intronic
1005077438 6:21922208-21922230 CTGTGTGACTTGGTGCAGGCAGG - Intergenic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006325793 6:33352865-33352887 CAGTGTGAGGAGAGTCAGGAGGG + Intergenic
1006592761 6:35170263-35170285 GGGAGTGAGTGGGGGCAGGAAGG + Intergenic
1007478337 6:42133990-42134012 CTGAGGGAGAAGGGGCAGGAGGG - Intronic
1007787227 6:44287583-44287605 CTCTGTGAGGAGGGGCACGATGG + Exonic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008868909 6:56248245-56248267 TTGTGTGTGTTGGGGTAGGAGGG - Intronic
1010519619 6:76817601-76817623 CTGTGTCTGCAGGGGCAGGGAGG - Intergenic
1010564116 6:77387723-77387745 CTGTGTGTGTTGGGGCGGGGGGG + Intergenic
1014140087 6:117931647-117931669 TTGTGTGAGTAGGTGAAGGTAGG + Intronic
1014339134 6:120180849-120180871 GTGTGTGGGTAGGTGCAGGGTGG + Intergenic
1015031686 6:128603002-128603024 GTGAGTGGGAAGGGGCAGGAGGG - Intergenic
1015323166 6:131898668-131898690 CTGTTAGAGGAGGGGCCGGAGGG - Intergenic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1015602083 6:134920425-134920447 CTGTGTGAATAGGGGAATGGAGG + Intronic
1015999503 6:139028959-139028981 CGGTGAGAGTCGGGTCAGGAGGG + Intronic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016540093 6:145154682-145154704 CTGTGTGAGTGAGGGTGGGAGGG + Intergenic
1016868637 6:148795227-148795249 CTGAATGAGAAGGGACAGGAGGG + Intronic
1017817568 6:158026819-158026841 CTGTGTCAGAAGAGGCAGGTGGG + Intronic
1017897204 6:158690998-158691020 CTGTGTGTGTGAGGCCAGGAAGG - Intronic
1018659509 6:166073278-166073300 CTGCGTGAGTGGGAGCAGCAGGG - Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018931323 6:168242151-168242173 CTGTCTGAGCAGGGGTAGGCTGG + Intergenic
1018991325 6:168676272-168676294 TGGTTTGGGTAGGGGCAGGAGGG + Intergenic
1019463210 7:1172444-1172466 CTGAGTGAGTAGGGGGAAGCTGG - Intergenic
1019670952 7:2278063-2278085 GTGTGTGTGTCGGGGCAGGAGGG - Intronic
1020603692 7:10308119-10308141 CTGTGTGAGTAAAAGCAGAAAGG - Intergenic
1020983508 7:15102447-15102469 GTGTGTGTGAAGGGGCAGGTGGG - Intergenic
1021746347 7:23745139-23745161 CTGTGTTGGTAGTGGCAGGTTGG + Intronic
1021951323 7:25777929-25777951 ATGCGTGAGTCTGGGCAGGACGG - Intergenic
1022020579 7:26396965-26396987 CTGGGTGTGTGGGTGCAGGAGGG + Intergenic
1022602258 7:31772443-31772465 CTGAGTAAGGAGTGGCAGGAAGG - Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023061466 7:36331392-36331414 CGGTGGGAGTAGGGGAAGGTGGG - Intronic
1023878719 7:44306845-44306867 GGGTGTGAGCAGGGGAAGGAAGG + Intronic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1024101303 7:46035527-46035549 CTGTGGCAGGAGGGGCAGCAGGG + Intergenic
1024362961 7:48487786-48487808 CTGTGTGTGAGGGGGCAGGGTGG + Intronic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1026434158 7:70379580-70379602 CTGTGTGTGTAGGTTCTGGAAGG + Intronic
1027649913 7:80853615-80853637 CTGGGAGGGTAGTGGCAGGAGGG + Intronic
1029547088 7:101216327-101216349 CTGGGTGAGGAAGGGGAGGATGG + Intronic
1030323536 7:108195131-108195153 TTTTGTGAGTAGTGGCTGGAGGG - Intronic
1030634791 7:111936599-111936621 CTGGGAGAGTAGTGGCAGTAAGG - Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1030896448 7:115066345-115066367 CTGTGTGTGAAGGGGCAGCATGG + Intergenic
1031467162 7:122126736-122126758 CTGGGTGGGTCGGGGCAGAAAGG - Intronic
1032035350 7:128517393-128517415 CTGTGGGTGGAGGGGCTGGAGGG + Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1033494145 7:141876953-141876975 CAGTGTGGGGAGGGGCAGGCAGG + Intergenic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1037806195 8:22059025-22059047 CTGGGTGGGGAGGGGCAGGGAGG - Intronic
1038016378 8:23519310-23519332 CTGTGCGAGAATGGGCTGGATGG - Intergenic
1038310285 8:26441107-26441129 CTGTGGGGGAAGGGGCAGGCGGG + Intronic
1038699461 8:29836334-29836356 CTGTGAGGCTAGAGGCAGGATGG - Intergenic
1038914803 8:32009239-32009261 CTGTTGGAGTAGGGGAATGATGG - Intronic
1039923293 8:41907771-41907793 CATTGAGAGTAGGTGCAGGAAGG - Intergenic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1043376150 8:79651972-79651994 CTATGGGAGGAGGAGCAGGAAGG + Intronic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1044514844 8:93126116-93126138 CTATCTGAGTAGGGCAAGGAAGG - Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1047024207 8:120809702-120809724 TTGTGTGACAAGGGGCAGGTGGG - Intronic
1047165582 8:122434633-122434655 CTGTGTGAATACAGGCAGGGTGG - Intergenic
1047171798 8:122500895-122500917 ATGTGTGAGCAGGGGCAACAGGG - Intergenic
1047179370 8:122572528-122572550 GTGTGTGCATGGGGGCAGGAAGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047776326 8:128073681-128073703 CTGTGTGAGGAGGGCTAGGGAGG - Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG + Intronic
1049203409 8:141352438-141352460 CTGTGTGTGAAGAGGCAGGGAGG + Intergenic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1049402486 8:142435708-142435730 CTGTGTGAGTTGGAGCAGGCAGG + Intergenic
1049414041 8:142487380-142487402 CAGTGAGCGGAGGGGCAGGAGGG - Intronic
1049709940 8:144058939-144058961 CTGTGGGATTTGGGGCCGGAGGG - Intronic
1049735377 8:144202318-144202340 CTCTGTGTGGAGGGGCAGGGAGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1050889479 9:10806188-10806210 CTGAGTGAAAAGAGGCAGGAGGG - Intergenic
1051665630 9:19464936-19464958 CTGTGGGACTAGGGGCTGGCGGG + Intergenic
1051845213 9:21444332-21444354 CTCTGTGTGAATGGGCAGGAAGG - Intergenic
1053507826 9:38659814-38659836 CTGTGTCAGTTTGGGGAGGAAGG + Intergenic
1053789020 9:41673120-41673142 CTTTGTTATTAGAGGCAGGAGGG - Intergenic
1054156121 9:61641641-61641663 CTTTGTTATTAGAGGCAGGAGGG + Intergenic
1054177302 9:61884473-61884495 CTTTGTTATTAGAGGCAGGAGGG - Intergenic
1054660231 9:67696335-67696357 CTTTGTTATTAGAGGCAGGAGGG + Intergenic
1056438757 9:86598832-86598854 CTGTGTGGGGTGGGGTAGGAGGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056931370 9:90880724-90880746 CTGTGTGGGCAGGGCCAGGTAGG + Intronic
1056950574 9:91037652-91037674 ATGTGTGCGTTGGGGCGGGAGGG - Intergenic
1057208747 9:93188161-93188183 CTGCGGGAGTAGGGGAAGAAAGG - Intronic
1057231407 9:93323785-93323807 CTGTGTGGGCCGGGGCAGGAGGG + Intronic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057287399 9:93769243-93769265 CTGTGTGTGTTGGGGCAAGCGGG + Intergenic
1058075866 9:100650280-100650302 CAGTGTGAGCATGGGTAGGAAGG + Intergenic
1058954045 9:109929437-109929459 CTGAGGGGGTAGGGGCAGGTGGG - Intronic
1058982345 9:110181710-110181732 CTGTGAGGTTAGGGGCAAGATGG + Intergenic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1059417874 9:114173141-114173163 CTGGGTGAGTTGGGGCGGGGAGG + Intronic
1059840681 9:118212265-118212287 CTCTGTGATTAGGTTCAGGAAGG + Intergenic
1059876427 9:118640595-118640617 GTGGGGGAGTAGGGGTAGGAGGG + Intergenic
1060153932 9:121305946-121305968 GAGTGTGAGAAGGGGCAGGGAGG + Intronic
1060246354 9:121949975-121949997 GAGTGTGAGTAGAGGCTGGATGG - Intronic
1060820986 9:126661588-126661610 CTGGGGCAGTTGGGGCAGGAGGG - Intronic
1060883726 9:127136203-127136225 CTCTGAGAGAAGTGGCAGGAAGG + Intronic
1061043319 9:128151780-128151802 ATCTGTGTGGAGGGGCAGGAAGG - Intronic
1061294956 9:129671993-129672015 CTGAGTAGGTGGGGGCAGGAAGG + Intronic
1062014105 9:134282687-134282709 CTGTGAGGGTAGGGACAGTACGG + Intergenic
1062212923 9:135374183-135374205 CTGTGGAAGTAGGTGGAGGAGGG - Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062446736 9:136598380-136598402 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1062446811 9:136598650-136598672 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1185758892 X:2674109-2674131 ATGTGTGAGCAAAGGCAGGAAGG - Intergenic
1186694056 X:12010684-12010706 CTATCTGATTAGAGGCAGGATGG - Intergenic
1187185957 X:16985863-16985885 CTGTGTGGGTAGTGGCATGGAGG + Intronic
1189279619 X:39812025-39812047 GTGTGTGGGTAGGGGGAGGTGGG - Intergenic
1189625767 X:42895262-42895284 CTGGGAGACTGGGGGCAGGACGG + Intergenic
1190481715 X:50883973-50883995 TGGTGGGAGTTGGGGCAGGAGGG + Intergenic
1194598698 X:95892565-95892587 ATGTGTGTGTTGGGGGAGGAAGG + Intergenic
1194933019 X:99912229-99912251 ATGTGTGTGTAGTGGCAGGCAGG - Intergenic
1195068720 X:101259991-101260013 CTGTCAGAGTAAGGTCAGGAAGG + Intronic
1196132275 X:112169894-112169916 ATGTGTCTGTAGGGGCAGGAGGG - Intergenic
1196524973 X:116720844-116720866 CAGTGTGATTAGGGGCAGCATGG + Intergenic
1196581432 X:117383705-117383727 GTGTGTGAGTAGGGGCATTCAGG - Intergenic
1196644605 X:118103728-118103750 CTGTGTGTGTTGGGGGAGGCAGG - Intronic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1200115844 X:153769398-153769420 CTCAGTGAGATGGGGCAGGATGG - Intronic
1200211113 X:154346908-154346930 CTGGGTGACTCGGGACAGGAGGG + Intergenic
1200219739 X:154385184-154385206 CTGGGTGACTCGGGACAGGAGGG - Intergenic