ID: 962755851

View in Genome Browser
Species Human (GRCh38)
Location 3:138465003-138465025
Sequence GGGTGCTAAAAGGCAGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962755840_962755851 22 Left 962755840 3:138464958-138464980 CCATCTGGATGCTCTGTTACGTT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 962755851 3:138465003-138465025 GGGTGCTAAAAGGCAGCTTGGGG 0: 1
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962755851 Original CRISPR GGGTGCTAAAAGGCAGCTTG GGG Intronic
902133548 1:14284450-14284472 GGGTTCCAAAAGGCAACTCGTGG + Intergenic
902609324 1:17588050-17588072 TGGTGTTAAATGGCAGCTTCTGG + Intronic
903809770 1:26028789-26028811 GGGTGCTGAAAGTCTGCCTGTGG + Intronic
904214775 1:28910791-28910813 AGGGGCTAACAGGCAGCTAGCGG + Intronic
904929602 1:34076010-34076032 GGGTGCCAGAAGGCAGCGTCTGG - Intronic
905676526 1:39829758-39829780 GGTTGCTAAAGGGAGGCTTGGGG - Intergenic
906567849 1:46813397-46813419 GGGTCCTGGAGGGCAGCTTGGGG + Intronic
913058315 1:115182452-115182474 GGTTGGTAAATGGCAGCTGGGGG - Intergenic
915787781 1:158635059-158635081 GGGGGCTAAAAGGAAGATTCTGG - Intronic
915899661 1:159837140-159837162 GGTTGCTAAGAGTCACCTTGTGG - Exonic
916094998 1:161341283-161341305 GGGTGCTAAAACTGAGCTTCTGG - Intronic
921540311 1:216406064-216406086 GGTTATAAAAAGGCAGCTTGAGG + Intronic
922417729 1:225436782-225436804 GGGAGCTAAGAGGCTGCTTGGGG - Intergenic
1064681823 10:17817832-17817854 GTTGGCCAAAAGGCAGCTTGTGG - Intronic
1065801239 10:29354922-29354944 GGGTGCCCATAGGCAGCTTCTGG - Intergenic
1066651954 10:37664778-37664800 GGGTGCCAGAAGGCAGTCTGTGG - Intergenic
1067160422 10:43820924-43820946 GGGTGCTGAAAGGAGGCTCGGGG - Intergenic
1067817267 10:49490266-49490288 GGAAGCTAAAGGGCAACTTGGGG + Intronic
1068526936 10:58141168-58141190 GGTGGCTCAAAGGCAACTTGGGG - Intergenic
1070104012 10:73414681-73414703 GAGTGGTAAAAGGTAGCTTCTGG + Intergenic
1071297525 10:84232950-84232972 TGGCCCTGAAAGGCAGCTTGGGG - Intronic
1071509126 10:86250328-86250350 GGCTGCTCAAAGGCAGCAGGAGG - Intronic
1073265814 10:102227852-102227874 GAGTGTTACAAGGCAACTTGGGG - Intronic
1076103904 10:127804859-127804881 GAGTGCAAAAGGGCAGCTTGGGG - Intergenic
1076118551 10:127918222-127918244 GGGTGCTCCAAGCCAGCCTGAGG - Intronic
1076670317 10:132117427-132117449 GGGCGCCAAAAGGCAGGTGGAGG + Exonic
1077366252 11:2162497-2162519 TGGTGCTAAGAGGCAGGTAGGGG - Intergenic
1077385520 11:2267791-2267813 GGACACTAAAAGGCAGCTTTCGG + Intergenic
1077654713 11:4007491-4007513 GGGTGCTAGTACCCAGCTTGTGG + Intronic
1078209769 11:9261399-9261421 GGGAGCTACAAGGCAGGCTGAGG + Intronic
1079718799 11:23784967-23784989 GGTTTCTCAAAGGCAGTTTGGGG + Intergenic
1080343459 11:31295379-31295401 GCCTGCTAAAAGGCACCTTGGGG - Intronic
1081593865 11:44445971-44445993 GGGTGCACAAAGGGAGGTTGAGG - Intergenic
1081834845 11:46144873-46144895 AGGTGCCAGAAGGCAGATTGGGG - Intergenic
1082797603 11:57389264-57389286 GGGTGCTAAGACGCTGCCTGAGG - Exonic
1084940166 11:72608154-72608176 AGCTGCTAAAAGGCTGCTAGAGG + Intronic
1086573266 11:88308695-88308717 GGTTTTTCAAAGGCAGCTTGGGG - Intronic
1093623143 12:21316043-21316065 GGGTGGTGATAGGTAGCTTGAGG - Intronic
1093722833 12:22464480-22464502 GGCTTCTTCAAGGCAGCTTGAGG - Intronic
1095137515 12:38623592-38623614 GGGTGCTACAAAGCAGCTATTGG - Intergenic
1095397871 12:41781181-41781203 GGGAGAAGAAAGGCAGCTTGGGG + Intergenic
1096335820 12:50755108-50755130 GGGTTCTAAAAGGGAGCATCAGG - Intergenic
1096828056 12:54294480-54294502 GGGGGCTAAGAAGCACCTTGGGG + Intronic
1097424963 12:59432900-59432922 GTGTGCTTATAGGAAGCTTGAGG - Intergenic
1100190311 12:92183715-92183737 GGATGCTAAAGGGCAGTTAGTGG - Intergenic
1100329908 12:93572538-93572560 GGGCGCTAACTGGAAGCTTGGGG + Intronic
1114781873 14:25547256-25547278 GGGTAATGAAGGGCAGCTTGAGG - Intergenic
1118284998 14:64463451-64463473 GGGAACTGAAAGGCAGTTTGAGG - Intronic
1120838837 14:89065002-89065024 GGCTCCTAAATGGCAGCTTCTGG - Intergenic
1121468626 14:94133565-94133587 GTGTGGTAGAAGGCAGCTGGTGG - Intergenic
1122365270 14:101191440-101191462 GGGTCCTGAGAGTCAGCTTGGGG - Intergenic
1123767883 15:23499884-23499906 GGGTGATAAAAGCCATTTTGAGG + Intergenic
1124006543 15:25799368-25799390 GGGTGCTCAAATGTAGCTTCTGG + Intronic
1126837694 15:52683920-52683942 GGGTTCTAAAAGACATTTTGAGG - Intronic
1130295270 15:82643171-82643193 GGTTGCTAAGAAGCAGCTAGAGG + Intronic
1130334470 15:82947343-82947365 GAGTACCAAAAGGCAGCCTGAGG + Intronic
1133447132 16:5871297-5871319 TGGTTCTTAAAGGCTGCTTGGGG - Intergenic
1133548727 16:6833465-6833487 GGGAGCTAAAATAAAGCTTGAGG - Intronic
1134204525 16:12226456-12226478 GGTTGATAGGAGGCAGCTTGTGG + Intronic
1135627711 16:24010653-24010675 GGGTGCTAAAGGACAGCAGGGGG - Intronic
1135847488 16:25931903-25931925 TGCTTCCAAAAGGCAGCTTGTGG + Intronic
1136128618 16:28204070-28204092 GGGTGTTCAAAGGGAGCTTTAGG - Intronic
1137296136 16:47095517-47095539 AGTTGCTAAAAGACAGCTAGGGG + Intronic
1137407373 16:48200266-48200288 GGGTGCTAACCTGCAGCTGGTGG + Exonic
1138972156 16:62158769-62158791 GTGTGCAAAAAGGGATCTTGTGG + Intergenic
1143117202 17:4587835-4587857 GGGAGCTGAGAGCCAGCTTGGGG + Intronic
1144062070 17:11591864-11591886 GGGTTTTCAAAGGCAGTTTGGGG + Intergenic
1145929300 17:28673280-28673302 GGTTGCTAAAAGGCTGTTTGTGG + Intronic
1147386653 17:40086609-40086631 GGGAGCTCCAAGGCAGCTTGGGG - Intronic
1147400793 17:40178866-40178888 GATGCCTAAAAGGCAGCTTGGGG - Intronic
1149995297 17:61403123-61403145 AGGTGCTGTAAGGCAGCTTCAGG - Exonic
1150166716 17:62950992-62951014 AGGTGCTAAAGGGCCGGTTGAGG - Intergenic
1158759760 18:60370644-60370666 GGGTGGGAAAAGGCAGCTATAGG - Intergenic
1159923168 18:74244726-74244748 GGGTGTGAAATGGCATCTTGTGG + Intergenic
1160213132 18:76901094-76901116 GGTTCCTAACAGGCAGCCTGGGG + Intronic
1160778148 19:866168-866190 GGGTGCTGAGAGGCGGCCTGTGG - Intergenic
1161080306 19:2307222-2307244 GCTTGCTAAAATGCAGCTTCTGG + Intronic
1161116027 19:2496941-2496963 AGCTGTTAAAAGGCAGCATGAGG - Intergenic
1161191757 19:2961291-2961313 GGGTGTTAAAACTCAGATTGTGG - Intergenic
1163232600 19:16014687-16014709 GCGTGCATAAGGGCAGCTTGAGG - Intergenic
1163700521 19:18784507-18784529 AGGGGCCAAATGGCAGCTTGGGG + Intronic
1165315351 19:35051995-35052017 GGGTGCTAGAAGCCAGTGTGAGG - Intronic
1165444503 19:35849421-35849443 GGGGGTTCAAAGGCAGGTTGTGG - Intronic
1166786858 19:45372743-45372765 GAGTGCTGAAAGGAAGCCTGTGG + Intergenic
1167054767 19:47102979-47103001 GCCTGCTAAAAGGAAGCTTGTGG + Intronic
927011844 2:18912050-18912072 GGGTGCTGAGAGGAAGGTTGAGG + Intergenic
927465477 2:23333081-23333103 GGGAGAGAAGAGGCAGCTTGCGG + Intergenic
928112927 2:28525181-28525203 GAGTTCTGACAGGCAGCTTGCGG + Intronic
929145361 2:38702710-38702732 GGGAGCTAGAAGGGAGCTTCAGG + Intronic
932347619 2:71005967-71005989 GGGTGCAAAGAGGAAGCTAGAGG - Intergenic
933535171 2:83563405-83563427 GTTTGCTAAGAGGAAGCTTGTGG - Intergenic
935120408 2:100179195-100179217 GAGTGCTAAAAGGCACCCTAGGG - Intergenic
935264654 2:101384063-101384085 GGGCTGTAACAGGCAGCTTGTGG - Intronic
937306573 2:120875262-120875284 GGGTGCTAACAGGCACAGTGTGG + Intronic
941717595 2:168780071-168780093 GGGTGGTTAAAGGCACCTTATGG + Intergenic
942363431 2:175196997-175197019 GGCTGTTAAAAGACAGCTGGTGG + Intergenic
948216506 2:236237221-236237243 GGATGCTAAAAGGCCACTGGCGG - Intronic
948367397 2:237466033-237466055 GGGTGTTCAAAGGCAGTTTGGGG - Intergenic
948551191 2:238773949-238773971 AGGAGCTAATAGGCAGCTTGTGG - Intergenic
1169137082 20:3203878-3203900 AGGTGCTCAGAGGTAGCTTGTGG + Intronic
1174609939 20:51790721-51790743 GGGTGCGATAATGCATCTTGAGG + Exonic
1179183664 21:39066659-39066681 AGGTGCTAAGAGGCACCCTGGGG - Intergenic
1179551910 21:42148861-42148883 GGGAGCTAAGAGGGAGCTTTGGG - Intergenic
1182287292 22:29255912-29255934 AGGTCCTAGAAGGCAGGTTGGGG + Intronic
949438021 3:4050121-4050143 GTGAGCCAAAAGGCAGCTTTTGG + Intronic
949694334 3:6676981-6677003 GGGTAGGAAAAAGCAGCTTGAGG - Intergenic
949819847 3:8104234-8104256 GAATGCTAAAATGCAGCTGGTGG - Intergenic
951441496 3:22728635-22728657 GGAAGCTAAAAGGCAGCTGGGGG - Intergenic
952300950 3:32104348-32104370 GGGTTTTTAAAGGCAGCTGGGGG - Intergenic
952584303 3:34872669-34872691 GGCTGGCACAAGGCAGCTTGAGG + Intergenic
954396701 3:50296935-50296957 GGGTGGTGAGATGCAGCTTGCGG + Exonic
955936828 3:64110214-64110236 GGGTTCTAGAAAGCAGCATGGGG - Intronic
957029317 3:75221636-75221658 GGGGGCCAAAAGGCAACTTTTGG + Intergenic
960896444 3:122511199-122511221 GGGTCAGAATAGGCAGCTTGGGG - Intronic
960896448 3:122511219-122511241 GGGTCAGAATAGGCAGCTTGGGG - Intronic
962755851 3:138465003-138465025 GGGTGCTAAAAGGCAGCTTGGGG + Intronic
964958987 3:162399758-162399780 GGGTCCTCAAAGTCAGCATGAGG - Intergenic
966480824 3:180406541-180406563 GGGTGCTACAATGAAGCTTGAGG - Intergenic
966839060 3:184073807-184073829 GAGTGCTAAAAGGCACCTCACGG + Intergenic
966914640 3:184578040-184578062 GGATGCTAAAGGGCAGTTCGAGG - Intronic
967065439 3:185911163-185911185 GAGTGCTAAAAGGCAGAATCTGG + Intergenic
967074716 3:185991645-185991667 GAGTGCTAAAAGGCAGAATCTGG + Intergenic
967224255 3:187275789-187275811 GGGTGCTAACAACCAGATTGGGG - Intronic
969330055 4:6469442-6469464 GGATGCTAAAATTCAGTTTGCGG - Intronic
970046610 4:11861614-11861636 GGGGGCCAAAAGGCAACTTTTGG - Intergenic
971956544 4:33427420-33427442 GACTGGTAAAAGGCAGCATGTGG + Intergenic
973277098 4:48321620-48321642 GGGTATTTAAAGGGAGCTTGTGG - Intergenic
975920855 4:79385309-79385331 GGCTGATGAAAGGCAGCATGTGG - Intergenic
980778079 4:137462261-137462283 GGCTTTTCAAAGGCAGCTTGGGG - Intergenic
981307563 4:143262958-143262980 GGGTCCCCAAAGGCATCTTGAGG + Intergenic
984154017 4:176172062-176172084 GGGTGCTAAATGGCATTTTTGGG + Intronic
985873470 5:2577454-2577476 CGGTGCAACAAGGCAGCCTGGGG + Intergenic
990716852 5:58646861-58646883 AGGTGCCAAGGGGCAGCTTGAGG - Intronic
991510002 5:67365784-67365806 GAGTGCGAAAAGGCAGGGTGGGG + Intergenic
994078889 5:95684066-95684088 GGGTGTTCTAAGGCAGATTGTGG - Intronic
995525227 5:113045371-113045393 GGGTCATAAAAAGCAGCTGGCGG - Intronic
998425642 5:142026034-142026056 GGGAACTAAAAGGCAGCAAGCGG + Intergenic
999685655 5:154100671-154100693 GGGTTTTAAAAGGTAGCTTTAGG + Intronic
1001051565 5:168418424-168418446 AGGTGCTGAAATACAGCTTGTGG + Intronic
1001091962 5:168748272-168748294 GGGTGCTTGGAGGCAGCTGGGGG + Intronic
1001881981 5:175252488-175252510 GTGAGCTCAAAGGCAGCTGGAGG - Intergenic
1003842519 6:10136750-10136772 GCCTGCAAAAAGGAAGCTTGGGG - Intronic
1004589478 6:17035117-17035139 GGGTGCTAAGAGGCAGTGTCTGG - Intergenic
1008233425 6:49013496-49013518 GGTTGTTTAAATGCAGCTTGGGG - Intergenic
1012917142 6:105182196-105182218 AGGAGCTGAAAGGCAGCTTCCGG + Intergenic
1013041479 6:106438280-106438302 GCATTCTAAAAGACAGCTTGAGG - Intergenic
1013889113 6:115004964-115004986 AGCTGCTCAAAGGCAGCTAGTGG + Intergenic
1015871017 6:137776409-137776431 GGGTGTTAAAAGGAGGCTTCCGG + Intergenic
1017907350 6:158765866-158765888 GGCTGCTGGAAGGCAGCTTGTGG - Exonic
1023911338 7:44559057-44559079 GGGTGCTAATAGTCAGGTGGTGG - Intergenic
1024389672 7:48793872-48793894 GAGAGCAAAAATGCAGCTTGTGG + Intergenic
1026107611 7:67433404-67433426 GGGAGCACAAAGGGAGCTTGTGG - Intergenic
1027263220 7:76479527-76479549 GGGTGCTAATAGGGAGGCTGAGG + Intronic
1027314604 7:76977632-76977654 GGGTGCTAATAGGGAGGCTGAGG + Intergenic
1028624798 7:92865361-92865383 GCTTGCTATAAGGCAACTTGTGG - Intergenic
1030757297 7:113302648-113302670 ATGTTCTAAAAGGAAGCTTGTGG + Intergenic
1031980518 7:128121578-128121600 GGGAGCGAAAAGATAGCTTGGGG + Intergenic
1034781286 7:153885065-153885087 GGATGGGAAAAGGCAGGTTGTGG + Intergenic
1035457171 7:159016179-159016201 GGCTTCTGAAAGGCAGCTCGGGG - Intergenic
1037539396 8:19856526-19856548 TGGTGCGAAAGGGCAGCTAGAGG + Intergenic
1043221686 8:77673619-77673641 GGGACTTAAAAGGCAGCTTCTGG + Intergenic
1044475167 8:92617445-92617467 AGATGTTAAAAGGCATCTTGAGG + Intergenic
1045378429 8:101599372-101599394 AAGTGCTAAAATGAAGCTTGGGG - Intronic
1050654412 9:7810688-7810710 GAGTGATAATAGGCAGCTTTGGG + Intronic
1051361031 9:16281852-16281874 GGTTGCAAAATGGCAGCCTGTGG + Intergenic
1053427120 9:38017435-38017457 GCCTGGTAAATGGCAGCTTGTGG + Intronic
1055301563 9:74887933-74887955 GGGCTGTAAAAGGCAGCGTGTGG - Exonic
1057192797 9:93096618-93096640 GGGGGCTACAAGGCAGCTCCAGG + Intronic
1061723746 9:132570031-132570053 GGCTCCTAAAAGGCAGCTAGAGG - Intronic
1061832893 9:133306965-133306987 GGATGCGAAAAGGCAGTTGGGGG - Intergenic
1189181962 X:39012885-39012907 GGGTGATAAAAGGAAACTTTGGG + Intergenic
1199595255 X:149501917-149501939 GGATGCTAAGAGGCAGCATCAGG - Intronic
1199768093 X:150954898-150954920 CGGTGCTAAAAGGCACCTCTGGG - Intergenic
1200246109 X:154526664-154526686 GGGTGGGCAAAGGCAACTTGGGG + Intergenic