ID: 962756245

View in Genome Browser
Species Human (GRCh38)
Location 3:138467547-138467569
Sequence ATCTGCAGGCTGGAATATAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962756245_962756254 27 Left 962756245 3:138467547-138467569 CCTGTATATTCCAGCCTGCAGAT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 962756254 3:138467597-138467619 AGTGGTGGATGAGGTACAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 193
962756245_962756250 9 Left 962756245 3:138467547-138467569 CCTGTATATTCCAGCCTGCAGAT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 962756250 3:138467579-138467601 AGATGTCATGACCAACAGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 173
962756245_962756252 18 Left 962756245 3:138467547-138467569 CCTGTATATTCCAGCCTGCAGAT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 962756252 3:138467588-138467610 GACCAACAGAGTGGTGGATGAGG 0: 1
1: 0
2: 1
3: 16
4: 145
962756245_962756251 12 Left 962756245 3:138467547-138467569 CCTGTATATTCCAGCCTGCAGAT 0: 1
1: 0
2: 0
3: 12
4: 165
Right 962756251 3:138467582-138467604 TGTCATGACCAACAGAGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962756245 Original CRISPR ATCTGCAGGCTGGAATATAC AGG (reversed) Exonic
902541500 1:17158813-17158835 TTCTGCAGGCTGGAAGGTCCAGG - Intergenic
904502979 1:30927944-30927966 ATCTGAATGCTTGAATATTCTGG - Intergenic
906769291 1:48470525-48470547 CTCTGCAGGCTTGAAGATAAAGG + Intronic
907563590 1:55413549-55413571 AAATGCAGGCTGGGATACACAGG + Intergenic
908570388 1:65403879-65403901 ATCTGCAGCCTGGCATCTAGAGG + Intronic
908767789 1:67569940-67569962 TTCTGCAGGCTGGTATCTGCAGG - Intergenic
909081508 1:71118141-71118163 ATATACAGGCTTGAATATCCTGG + Intergenic
909675207 1:78231637-78231659 ATCTGCAAGCTGGAAAACAAGGG - Intergenic
910597179 1:88992740-88992762 ATCTCTAGGCTGGAAGAGACTGG + Exonic
910706706 1:90138181-90138203 ATCTGGAATCTGGAATATATAGG + Intergenic
912962946 1:114212174-114212196 AGCTGCAGGCTGGAGTTTAAGGG - Intergenic
917840361 1:178972698-178972720 ATCTGCACACTGGAATATTTGGG - Intergenic
920702816 1:208230752-208230774 AACTGCAGGTAGGAAGATACAGG - Intronic
921756795 1:218866492-218866514 ATCTGAAGGCTACAATAAACTGG - Intergenic
921787942 1:219254607-219254629 TTCTACAGGCTGGAAGAAACTGG - Intergenic
922680190 1:227588537-227588559 GTCACCAGGCTGGAATATAATGG + Intronic
923294870 1:232584262-232584284 ATCAGCAGGCTGGAGTATAGTGG + Intergenic
923543954 1:234910431-234910453 AACTGCAGGTTGGAATCCACTGG - Intergenic
1062857651 10:787284-787306 ATCTGGAGGCTGGAAGTTCCGGG - Intergenic
1068059663 10:52051494-52051516 TTCTGCAAGCTGGATTATTCTGG + Intronic
1068411573 10:56662136-56662158 ATTTGCATGCTGGAATATGTGGG - Intergenic
1069990776 10:72314617-72314639 GTCACCAGGCTGGAATACACTGG - Intergenic
1071109814 10:82142808-82142830 ATCTCCAGGCTGGAATGCAGTGG + Intronic
1072229285 10:93399982-93400004 GGCTGGAGGCTGGCATATACTGG - Intronic
1080859120 11:36137988-36138010 ATCTTAAGGGTGGAATTTACTGG + Intronic
1083866654 11:65458282-65458304 GTCTCCAGGCTGGAATACAGTGG + Intergenic
1084619377 11:70258669-70258691 GTCTCCAGGCTGGAATGTAGTGG + Intergenic
1085186467 11:74580011-74580033 AACTGAAGGCTGGAATCTGCAGG - Intronic
1086161350 11:83725409-83725431 AGCTGCAGGCTGGAATCTGCTGG + Intronic
1086827245 11:91514460-91514482 TTCTACAGGCTGGATCATACAGG - Intergenic
1087205079 11:95386055-95386077 ATCTGCAGGGTTGAAGATCCTGG - Intergenic
1087209060 11:95427725-95427747 ATCCCCAGGCTGGAATGTAGTGG - Intergenic
1088360777 11:108986788-108986810 ATCTGGAAGCTAGAAGATACTGG + Intergenic
1095764911 12:45884354-45884376 TTGAGCAGGCTGGAGTATACTGG - Intronic
1100963992 12:99992479-99992501 ATCTGCAGAAAGGAATATATAGG + Intergenic
1100977245 12:100135306-100135328 CTCTGCAGGCTGGAGTGTAGTGG + Intronic
1101059570 12:100957140-100957162 TTCTACAGGCTGGAAAATACAGG + Intronic
1101059652 12:100957761-100957783 TTCTGCAGGCTGGAAAGTACAGG - Intronic
1101204650 12:102474483-102474505 ATCTCCAGACTGGTATACACAGG + Intronic
1102306040 12:111805362-111805384 ATCACCAGGCTGGAGTGTACTGG + Intronic
1102784264 12:115591421-115591443 ATCTGGAGGCTGGAAAGTCCTGG - Intergenic
1104416058 12:128597436-128597458 TTCTGCAGGCTGGAGTACAGTGG - Intronic
1104959543 12:132481943-132481965 GTCTGCAGGCTGGACAACACCGG + Intergenic
1105515116 13:21082666-21082688 TTCTGCAGGCTGGAAAGTTCAGG + Intergenic
1106604144 13:31212141-31212163 TTGTCCAGGCTGGAATATAGTGG + Intronic
1107202397 13:37737510-37737532 TTCCGCAGGCTGGAATGCACTGG + Intronic
1115175925 14:30561517-30561539 ATCAGCAGGTTGGAAGAGACTGG - Intronic
1115799170 14:36972870-36972892 TCATGCAGGCTGGAGTATACTGG + Intronic
1116165632 14:41330893-41330915 ATATCCAGGCAGGAAAATACAGG - Intergenic
1116728074 14:48587880-48587902 ATGTCCAGGCTGGAATCTATAGG + Intergenic
1117311939 14:54534752-54534774 ATCACCAGGCTGGAATATAGTGG + Intronic
1118412970 14:65501948-65501970 ATGCCCAGGCTGGAATATAGTGG + Intronic
1124635979 15:31365570-31365592 ATCTGCAGTGTGGTTTATACAGG + Intronic
1125358726 15:38843718-38843740 GTCTCCAGGCTGGAGTATAGTGG + Intergenic
1126155466 15:45561773-45561795 TTGTCCAGGCTGGAATATAGTGG - Intergenic
1128696271 15:69765427-69765449 GTCTCCAGGCTGGAATGTAGTGG + Intergenic
1129586119 15:76867870-76867892 TTCTGCATGCTAGAATATAGGGG + Intronic
1130018915 15:80210789-80210811 ATCTGGAGGCTGGAATTCCCAGG + Intergenic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1134467414 16:14491730-14491752 TTGCGCAGGCTGGAATATAGTGG - Intronic
1134623945 16:15710714-15710736 CTCTGAAGGCTGGAGTATAGAGG + Intronic
1140124855 16:72110618-72110640 ACCTGCTGGCTGGAAGAGACAGG - Intronic
1142659671 17:1419193-1419215 TTGTGCAGGCTGGAGTATAGTGG - Intergenic
1145183089 17:20770269-20770291 ATTTGCAGGCTGGAGTGTAGTGG + Intergenic
1150877875 17:68989753-68989775 ATCTGAAGACTGGATTATTCAGG - Intronic
1150950162 17:69794637-69794659 ATCACCAGGGTGGAATTTACAGG + Intergenic
1151734928 17:75933386-75933408 AACTGTAGGCTGGAATACATGGG + Intronic
1152229480 17:79107292-79107314 AGCAGCAGGCTGGAATAAGCAGG - Intronic
1152714921 17:81894550-81894572 ATCTGCAGGATGGCATTTAACGG + Exonic
1157038538 18:44008355-44008377 CTCTGCAGGCTGGAGTGTAGTGG + Intergenic
1159506995 18:69351521-69351543 ATGTCCAGGCTGGAATACAGTGG - Intergenic
1159572516 18:70134071-70134093 ATGTGCATGCTGGAATATATAGG + Intronic
1160173358 18:76572700-76572722 ATCTGCAGGCTAGAGTTTCCAGG + Intergenic
1162230498 19:9261993-9262015 ATCTGAAGGCTGGAAGGTAGAGG + Intergenic
1164197623 19:22984517-22984539 ATCTCCAGGCTGGAGTGTAGCGG - Intronic
1165964582 19:39565069-39565091 TTCTGGAGGCTGGAATATCCAGG + Intergenic
1168109520 19:54184200-54184222 GTCACCAGGCTGGAGTATACTGG + Intronic
927888380 2:26732386-26732408 ACCTGCAGATTGAAATATACTGG + Exonic
930581771 2:53220122-53220144 TTCTGGAGGCTGGAAAATCCAGG - Intergenic
933140619 2:78788498-78788520 GTCACCAGGCTGGAATATAGTGG + Intergenic
933648035 2:84828180-84828202 GTCAGCAGGCTGGAAAACACAGG - Intronic
940923468 2:159336875-159336897 ATCTGGAGGTTGGAAGAAACAGG + Intronic
941102945 2:161317453-161317475 CTTTGCAGGGTGGAATAGACTGG + Intronic
941363022 2:164576450-164576472 ATCTGTATTCTGGAATTTACTGG - Intronic
941627165 2:167842831-167842853 TTGTGCAGGCTGGAATACAGTGG - Intergenic
944575772 2:201089765-201089787 ATCACCAGGCTGGAATACAGTGG - Intergenic
1168841442 20:912477-912499 AGCTGCAGGCAGGAATATTGAGG - Intronic
1170903195 20:20486098-20486120 TTGTCCAGGCTGGAATATAGTGG - Intronic
1171439885 20:25151552-25151574 TTGTGCAGGCTGGAATGTAAAGG - Intergenic
1172262329 20:33578838-33578860 ATCTGAAGGATGGCATAAACTGG + Intronic
1173659612 20:44724421-44724443 ATTTGCAAGCTGGGATATAATGG - Intronic
1175066884 20:56296666-56296688 ATCTGCAAGTTGGAGTATATGGG + Intergenic
1175654728 20:60760171-60760193 ACCTGGAGGCTGGAGTCTACAGG + Intergenic
1176191610 20:63813407-63813429 GTCTCCAGGCTGGAGTATAGTGG - Intronic
1177829530 21:26121947-26121969 AGCTGCAGGTGGGAATATAATGG + Intronic
1178571328 21:33739867-33739889 ATCTGAAGACTGGAATGTAGGGG + Intronic
1179180772 21:39043029-39043051 GTCTGAAGGCTGGAAAAAACTGG - Intergenic
1179664964 21:42904828-42904850 ATCTCCAGGCTGGAGTGTAATGG + Intronic
1182831015 22:33304499-33304521 ATCTGGAGCCTGGAAGAGACAGG + Exonic
1183521889 22:38300456-38300478 TGGTGCAGGCTGGAAGATACAGG - Intronic
1184494331 22:44828752-44828774 ACCTGATGGCTGGAATATCCTGG - Intronic
1184717857 22:46292023-46292045 TTCTGGAGGCTGGAATGTCCAGG + Intronic
949122402 3:402489-402511 GTCTGTTGGCTGAAATATACAGG - Intronic
950238079 3:11341099-11341121 CTGTGCAGGCTGGAATACAATGG + Intronic
951620420 3:24595487-24595509 AACTGGAGACTGGAATATACTGG + Intergenic
951966571 3:28392331-28392353 ATCTGAAGGCAGAAATAGACAGG + Intronic
952537290 3:34324237-34324259 ATCTGCATACTGGAATGAACTGG + Intergenic
952673998 3:36004699-36004721 ATGGGCAGGCTGGAATTTATGGG - Intergenic
953713288 3:45293474-45293496 ATCTGCAGGCAGGAAAATGTGGG + Intergenic
955689862 3:61580418-61580440 GTCTCCAGGCTGGAATGTAGTGG + Intronic
956028100 3:65005609-65005631 AACTGGAGGCTAGAACATACTGG - Intergenic
957213088 3:77286294-77286316 ATCACCAGGCTGGAGTATATTGG + Intronic
962756245 3:138467547-138467569 ATCTGCAGGCTGGAATATACAGG - Exonic
967599159 3:191364106-191364128 GTCTCCAGGCTGGAGTATAGTGG + Intronic
967879894 3:194294350-194294372 ATCTGCAGGGTGGAAGAGAAAGG - Intergenic
969310417 4:6349849-6349871 GTCACCAGGCTGGAATATAATGG - Intronic
975434034 4:74330435-74330457 ATCACCAGGCTGGAATGTAGTGG - Intergenic
975446609 4:74472946-74472968 ACCTGCAGACAGGAATATTCTGG - Intergenic
975655907 4:76641055-76641077 AACTGTGGGCTGAAATATACTGG + Intronic
975710992 4:77158911-77158933 AGCTGCAGGCTGGAGTATGGGGG - Intronic
976927807 4:90523064-90523086 ATCTTCAGGTAGGAATATATTGG + Intronic
977501561 4:97846273-97846295 CACTGAAGGGTGGAATATACGGG + Intronic
979722774 4:123921333-123921355 TTCTGCAGGCTGGAAAGTTCAGG + Intergenic
987587571 5:19876279-19876301 ATCCTGAGGCTTGAATATACAGG + Intronic
989325645 5:40190464-40190486 TTGTCCAGGCTGGAGTATACTGG - Intergenic
990328790 5:54704976-54704998 TTCTGCAGGCTGGAGTACAGTGG + Intergenic
990432256 5:55747336-55747358 ATCTCCAGGCTGGAGTACAGTGG - Intronic
991936743 5:71809674-71809696 ATCTGTGTGCTGGAATATAATGG - Intergenic
995508206 5:112882169-112882191 ATATGTAGGGTGGAATATAAGGG - Intronic
997795384 5:136804551-136804573 ATCTGCAAGCTGGAAAATCAGGG + Intergenic
1001967537 5:175921825-175921847 ATCTCCAGGCTGGAATCAATAGG + Intronic
1001978858 5:176023674-176023696 ATCACCAGGCTGGAGTGTACTGG - Intronic
1004960629 6:20784171-20784193 ATCTCCAGGCTGGAGTTTAGTGG - Intronic
1006033855 6:31197070-31197092 GCCTGGAGGCTGGAATACACCGG - Intergenic
1006057922 6:31399664-31399686 GCCTGGAGGCTGGAATATACCGG - Intergenic
1006070306 6:31493874-31493896 GCCTGGAGGCTGGAATACACCGG - Intergenic
1011078828 6:83467027-83467049 ATCCTCAGGCTGGGATATAAGGG + Intergenic
1011716162 6:90107330-90107352 GTCTCCAGGCTGGAATGTAGTGG - Intronic
1012172980 6:96042557-96042579 ATATGCATGCTGGAGTATACAGG - Intronic
1013061265 6:106636358-106636380 GTCTCCAGGCTGGAATACAGTGG + Intronic
1013485898 6:110595694-110595716 TTATGCAGGCTGGAGTATACTGG - Intergenic
1015312465 6:131780799-131780821 ATCTGCAGGCTGAAAGAGCCGGG - Intergenic
1015407778 6:132856846-132856868 TTCTCTGGGCTGGAATATACTGG - Intergenic
1016476216 6:144432261-144432283 ATGTGCAGGCTGCCATATAATGG - Intronic
1019399375 7:843292-843314 ATCTGCAGACTGTGATAAACAGG + Intronic
1020174386 7:5870582-5870604 ATCTGAAGGCTGGTACATTCTGG + Intergenic
1020249696 7:6457723-6457745 TTCTGCAGGCTGGAGTACAGTGG + Intronic
1020249937 7:6459575-6459597 ATCTGTAGCCTGGAATCTGCTGG - Intronic
1026999311 7:74641060-74641082 AGCACCAGGCTGGAGTATACTGG + Intergenic
1027526864 7:79279972-79279994 ATCTGTAGTCTGGAATATAAAGG + Intronic
1029043364 7:97600734-97600756 TTCTGCAGGCTGGAATGTGGTGG - Intergenic
1031069113 7:117142649-117142671 GTCTCCAGGCTGGAATACAGTGG + Intronic
1031233895 7:119146714-119146736 ATTAGCAGGCTGGACTACACAGG + Intergenic
1033983167 7:147191148-147191170 ATCTGAGGGGTGAAATATACTGG - Intronic
1035421482 7:158732464-158732486 TTCAGCAGGAGGGAATATACTGG + Exonic
1038726990 8:30090445-30090467 AGCTGCAGGCTGGAGTACAGTGG - Intergenic
1042408602 8:68435440-68435462 TGCTGCAGGCTGGTATATTCAGG - Intronic
1045803825 8:106133339-106133361 TTCTGCAGGCTGGGAAGTACAGG - Intergenic
1046078959 8:109347003-109347025 ATTTGAAGCCTGGAATAAACTGG - Intergenic
1048223380 8:132563497-132563519 ATCTGGAGGCTGGAATCATCTGG - Intergenic
1052922316 9:33981393-33981415 ATCTGAAGGCTGGAGTGTAGTGG + Intronic
1053290516 9:36876589-36876611 ATCTTCAGGCAGGAATCAACTGG + Intronic
1058139901 9:101346264-101346286 AGCTGCAGTCTGGAATTGACTGG + Intergenic
1062158846 9:135068793-135068815 GTCTGCAGGCTGGAATGCAGTGG - Intergenic
1185465027 X:349300-349322 GTCTGCAGGCTGGAAGATCTCGG - Intronic
1185930085 X:4193025-4193047 ACCAGCAGGCTGGAAGATAAAGG - Intergenic
1187573562 X:20530564-20530586 ATTTGCAGGATGGAAGAAACAGG + Intergenic
1189263037 X:39691592-39691614 ATCTGCAGGCTGGACTGGGCTGG + Intergenic
1190568442 X:51755827-51755849 AGATGCAGGGAGGAATATACAGG + Intergenic
1194969252 X:100324898-100324920 ATCTGCAGAATGGAGGATACTGG - Intronic
1195082337 X:101383573-101383595 AGCTGGAAGTTGGAATATACTGG - Intronic
1197047970 X:122023095-122023117 TTCTGCAAGCTAGAATATCCAGG - Intergenic
1197209956 X:123820266-123820288 ATCTGCAGGCTGGAGTGCAGTGG + Intergenic
1197520141 X:127487252-127487274 ATCTGCACTATGGAATATATGGG - Intergenic
1198499033 X:137224226-137224248 ATCTGGAGGCTGGAAAGTCCAGG - Intergenic
1201524842 Y:14920748-14920770 GTCAGCAGGCTGGAATACAGTGG + Intergenic
1201558512 Y:15290328-15290350 ATCACCAGGCTGGAATGTAGTGG + Intergenic
1201709885 Y:16979187-16979209 ACCAGCAGGCTGGAAGATAAAGG - Intergenic