ID: 962756277

View in Genome Browser
Species Human (GRCh38)
Location 3:138467718-138467740
Sequence TGTGCTAGGCTCCATCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962756269_962756277 6 Left 962756269 3:138467689-138467711 CCAGCTATTCCTATGCTGTGGTC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 962756277 3:138467718-138467740 TGTGCTAGGCTCCATCCTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 200
962756268_962756277 7 Left 962756268 3:138467688-138467710 CCCAGCTATTCCTATGCTGTGGT 0: 1
1: 0
2: 0
3: 2
4: 151
Right 962756277 3:138467718-138467740 TGTGCTAGGCTCCATCCTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 200
962756270_962756277 -3 Left 962756270 3:138467698-138467720 CCTATGCTGTGGTCCCCCTCTGT 0: 1
1: 0
2: 2
3: 12
4: 158
Right 962756277 3:138467718-138467740 TGTGCTAGGCTCCATCCTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 200
962756266_962756277 24 Left 962756266 3:138467671-138467693 CCAGCAGCTTGCTTCAGCCCAGC 0: 1
1: 1
2: 0
3: 60
4: 356
Right 962756277 3:138467718-138467740 TGTGCTAGGCTCCATCCTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962756277 Original CRISPR TGTGCTAGGCTCCATCCTCA GGG Intronic
900428996 1:2593200-2593222 GGTGCTAGGCCCTAGCCTCAGGG - Intronic
900676024 1:3886837-3886859 AGTGCCAGGCTCCATCCAGACGG + Intergenic
901240673 1:7691351-7691373 TGTGCCAGGCTTTATCCCCAAGG + Intronic
902550701 1:17217472-17217494 TGTACCAGGGTCCTTCCTCAAGG + Intronic
903863008 1:26376545-26376567 TGGGCCAGGCACCATCCTAAGGG - Intergenic
903877644 1:26486457-26486479 GGTCCTAGGCCCCATCTTCAGGG - Intergenic
905002482 1:34683852-34683874 TGTGCCAGGCTCCCTTCTAAGGG - Intergenic
906927316 1:50132251-50132273 TGTTCTGTGCTCCATCTTCAAGG - Intronic
907826071 1:58017896-58017918 AGTGCTGGGCTGCAGCCTCAAGG - Intronic
909529520 1:76666680-76666702 TGGGCGTGGCTCCAACCTCAGGG + Intergenic
916662551 1:166935812-166935834 TGTGCTAGGCTGCCTCCAGAGGG - Intronic
919938381 1:202269886-202269908 CGTGCAAAGCTCCATGCTCAGGG - Intronic
921574186 1:216815238-216815260 TGTGCCAGGCACCATGCTCAGGG + Intronic
922452057 1:225745369-225745391 TCTGCCAGGCTCCATGATCAGGG - Intergenic
922874307 1:228927923-228927945 TGTGCCAGGCTCTATTCTAAAGG + Intergenic
923028382 1:230225541-230225563 TGTGTTAGGCTTCATAGTCATGG + Intronic
923074159 1:230594471-230594493 TGTCCTAGGCTCCATCCTTGAGG - Intergenic
1062933449 10:1368073-1368095 TGTGCTGGGCTCCCACGTCAGGG - Intronic
1063364413 10:5480991-5481013 TCTGGTGGGCTCCGTCCTCACGG + Intergenic
1063364423 10:5481034-5481056 TCTGGTGGGCTCCGTCCTCACGG + Intergenic
1063364433 10:5481077-5481099 TCTGGTGGGCTCCGTCCTCACGG + Intergenic
1064142973 10:12805951-12805973 TTTGCTAGGCACCATCATCGTGG - Intronic
1064416233 10:15152617-15152639 TGGGCCTGGCCCCATCCTCAGGG - Intronic
1065963296 10:30751630-30751652 GGTACCAGGCTCCATGCTCAAGG + Intergenic
1066474753 10:35735721-35735743 TGTGCAGGGCTCCATCATCTAGG + Intergenic
1068170297 10:53384052-53384074 TGTACCAGGCTACCTCCTCATGG - Intergenic
1069256637 10:66339956-66339978 TCTGCAAGGCTCCATCCACTCGG - Intronic
1070275671 10:75004266-75004288 TGTGCTAGGCACTGTGCTCATGG - Intronic
1070622819 10:78026954-78026976 TGTGCCAGGCACCATCCTACAGG + Intronic
1072248181 10:93561207-93561229 GGTGCAAGGCTCCTTCTTCAAGG - Intergenic
1072631046 10:97146715-97146737 TGTGCTGGGCTCCAGCTTCATGG - Intronic
1076193595 10:128499580-128499602 TGTGCGTGCCTCCCTCCTCACGG - Intergenic
1076804647 10:132849390-132849412 TGTGCCTGGCTCCATGCCCAGGG - Intronic
1079449013 11:20583138-20583160 TGTTCTAAGCACCATCCTAAGGG - Intergenic
1084542696 11:69797434-69797456 ACTGCCCGGCTCCATCCTCATGG + Intergenic
1086278425 11:85158998-85159020 TGTAGTAGGGTCCTTCCTCAAGG - Intronic
1086636247 11:89089602-89089624 CGTCCTAGGATCCATCTTCAGGG + Intergenic
1086728146 11:90215442-90215464 TGTGCTATGCCCTATCATCAAGG + Intronic
1087508370 11:99057646-99057668 TGTGCTAGGCACTGTTCTCAGGG + Intronic
1087509405 11:99071090-99071112 TTTGCTAGGATCATTCCTCAGGG + Intronic
1089903413 11:122012144-122012166 TGTAGTAGGGTCCTTCCTCAAGG - Intergenic
1090557073 11:127887666-127887688 TGTGTTAGGCTTTTTCCTCAGGG + Intergenic
1091174972 11:133549547-133549569 TGTGCCAGGCACTATGCTCATGG - Intergenic
1091789399 12:3263065-3263087 TGTGCTGGGTTCCAGCCTCCTGG + Intronic
1092209139 12:6635198-6635220 AGAGGTAGGCCCCATCCTCATGG + Intronic
1093997271 12:25655630-25655652 TGGGCCAGGCTACATCTTCAGGG + Intergenic
1096260658 12:50088312-50088334 TGTTCTAGGCTGCTTCTTCAGGG + Intronic
1096485796 12:51980192-51980214 TGTATTAGGCTCCATGCTAAGGG - Intronic
1098807045 12:75033540-75033562 TGTACTGGGATCCTTCCTCAAGG - Intergenic
1099917027 12:88907641-88907663 TGTGGTATGCTCCCTCCTCTTGG - Intergenic
1101647330 12:106643329-106643351 TGTGCTATGCTCCAACCACATGG - Intronic
1102002678 12:109567219-109567241 TGTGCTAGGCACTGTCCTCAGGG + Intronic
1102034684 12:109764239-109764261 TGTGCTAGGCTCCAGGGCCATGG - Intronic
1103795820 12:123502520-123502542 TGTGCCAGGCACCATCTTCAGGG - Intronic
1103967369 12:124648263-124648285 TGTGCCAGGCACCAGCCTGAGGG - Intergenic
1104175802 12:126331492-126331514 TGTTCAATGCTCCAACCTCATGG - Intergenic
1108255121 13:48602396-48602418 AGTGCTGGGCTCCACCCCCAGGG - Intergenic
1110165866 13:72442378-72442400 AGTCCAAGTCTCCATCCTCATGG - Intergenic
1112414455 13:99192694-99192716 TGTGGTAGGCTACACCCTCCAGG + Intergenic
1112522845 13:100113142-100113164 TGTACTAGGCTGTATCATCAAGG - Intronic
1113395995 13:109948381-109948403 TGTAGTAGGGTCCTTCCTCAAGG - Intergenic
1115437269 14:33388890-33388912 TTTGCTAGGCACAATCCACAGGG - Intronic
1115813880 14:37141845-37141867 TGATACAGGCTCCATCCTCAAGG + Intronic
1116767422 14:49089906-49089928 TATACTAGGCTCCATCATCTAGG + Intergenic
1117092942 14:52268414-52268436 TGTGCTCTACTCCAGCCTCATGG + Exonic
1117933628 14:60875612-60875634 TGTGCTAGGCACTATGCTAAAGG - Intronic
1119866020 14:77975183-77975205 TGTGCTTGGCTCAATTCCCATGG - Intergenic
1120813648 14:88830638-88830660 TGGGCTAGGCTTGATCCTCAGGG - Intronic
1121680515 14:95789260-95789282 GGTGCCAGGCTCCCTCCTCCAGG + Intergenic
1122346939 14:101066632-101066654 TGTGCTGGCCTCCATCCTGGAGG + Intergenic
1131305014 15:91234736-91234758 TGTACTGGGGTCCCTCCTCAAGG - Intronic
1132939969 16:2501640-2501662 TGTGCTGGGCTCCACCCCCAGGG + Exonic
1134818888 16:17229477-17229499 TGGGCTAGGCCCCAGCCTTATGG + Intronic
1135061875 16:19277948-19277970 TGTACCAGGGTCCTTCCTCAGGG + Intergenic
1140201545 16:72898856-72898878 TCTGGTAGGCCCCTTCCTCAGGG - Intronic
1144729074 17:17516529-17516551 TGGGATAGGCTCAAGCCTCACGG + Intronic
1149447333 17:56723814-56723836 TGTGCTTGGCTCCAAACTCTGGG + Intergenic
1149455818 17:56787372-56787394 TGTGCTGTGCTTCTTCCTCAGGG - Intergenic
1151828097 17:76534877-76534899 TGTGCCTGGCTCCTTCCTCCTGG + Intronic
1152145299 17:78564721-78564743 TGTGCTAGGCTCAGTTCTAAGGG + Intronic
1152773941 17:82188189-82188211 TGTGCTTGGCTCCACCCAGAGGG - Intronic
1156537588 18:37879055-37879077 TGTAGTAGGGTCCTTCCTCAAGG - Intergenic
1156830035 18:41480792-41480814 TGCTCTAGGCTCTATCCTCTTGG + Intergenic
1157166836 18:45365439-45365461 TGTGCTAGGCACGAACTTCATGG + Intronic
1158913786 18:62098124-62098146 TGTGCTAGGCACTATGCTCAGGG - Intronic
1159028648 18:63209144-63209166 TGTGGTAGGGTCCTTCGTCAAGG + Intronic
1162752385 19:12836657-12836679 TGTGCTAGGCACCATGCTAAGGG + Intronic
1163793026 19:19319363-19319385 TGTGGAAGGCTCCACCCTCCAGG + Intronic
1164863888 19:31587832-31587854 TGTATAAAGCTCCATCCTCATGG - Intergenic
1165097473 19:33417431-33417453 TGTGCTGGGCTCCCTGCTCTGGG + Intronic
1165167223 19:33865322-33865344 TGTCCTAGGCACCATGCTAAGGG + Intergenic
1166785335 19:45363885-45363907 AGTGCCTGGCTCCATCCGCACGG - Exonic
1168129649 19:54310117-54310139 GGTGAGGGGCTCCATCCTCAGGG + Intronic
927874094 2:26642896-26642918 TCTGCCAGGCTCTATCCCCATGG - Intergenic
929219385 2:39447940-39447962 TGAGGTAGGCTCTATCCTCTAGG + Intergenic
930456465 2:51613238-51613260 TGTACTGGGGTCCTTCCTCAGGG + Intergenic
931017917 2:58006968-58006990 TGTACTGGGGTCCTTCCTCAAGG - Intronic
932475648 2:72004099-72004121 TGGGCTGGGCTGCAGCCTCATGG - Intergenic
934039715 2:88117726-88117748 TTTGCTATGTTCCGTCCTCATGG + Intergenic
934660534 2:96141169-96141191 TGTGCCAGGCTCCAGGCACAAGG + Intergenic
934776313 2:96939845-96939867 TGTGCTAGGCACCAAGCCCAGGG - Intronic
936381680 2:111992139-111992161 TGTGCGTGGCTCCTTCCTCCAGG - Intronic
941143589 2:161815656-161815678 GATGCTAGGCTTCAACCTCAAGG + Intronic
941597679 2:167498018-167498040 TGTGTTAGGCTTCATACTTAAGG + Intergenic
942603422 2:177664884-177664906 ATTGCTTGGCTCCACCCTCATGG - Intronic
946395902 2:219443593-219443615 TGTGACAGGCACCTTCCTCAAGG - Intronic
947291520 2:228580858-228580880 TCTTCTAGGCTACATCCTCAGGG - Intergenic
1170099894 20:12687410-12687432 TGGGCTAGAATCCATCCTAAGGG - Intergenic
1171330252 20:24331136-24331158 AGTGCCAGGATCCTTCCTCAAGG + Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1171510244 20:25676543-25676565 TGGGCGAGGCTTCAGCCTCAAGG - Exonic
1172227560 20:33315242-33315264 TGTGCCAGGCACCATGCTGAGGG - Intergenic
1172977115 20:38914433-38914455 TGTGGTAGGCACCATCATCTTGG - Intronic
1173140244 20:40475510-40475532 AGTGATAAGCTCCATCCCCAGGG + Intergenic
1173973262 20:47168581-47168603 TGTGCCAGGCACTATCCCCAGGG - Intronic
1176623585 21:9074058-9074080 TGTGCGGAGCTCCATGCTCAGGG + Intergenic
1179458399 21:41515593-41515615 TGTCCTGGGATCCTTCCTCAAGG + Intronic
1179798528 21:43799562-43799584 TGTTCCAGGCTCCATCTGCAGGG + Exonic
1180873498 22:19162048-19162070 TGTTCCTGGCTCCTTCCTCATGG + Intergenic
1180919967 22:19516573-19516595 TGTGCCATGCTCCATGCTCAGGG - Exonic
1181340846 22:22178778-22178800 TGAGCTGGGCTCCAGCCCCAGGG + Intergenic
1184638936 22:45858629-45858651 GGTGCTGGGGTCCTTCCTCAAGG + Intergenic
1184835939 22:47021118-47021140 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184835948 22:47021161-47021183 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184835957 22:47021204-47021226 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184835967 22:47021247-47021269 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184835978 22:47021290-47021312 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184835989 22:47021333-47021355 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184835998 22:47021376-47021398 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184836007 22:47021419-47021441 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184836016 22:47021462-47021484 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
1184836043 22:47021590-47021612 TCTGCTAGGTTCCCTGCTCAGGG - Intronic
949305832 3:2639616-2639638 TGTGCCAGGCACTATTCTCAGGG - Intronic
950903011 3:16513774-16513796 TATGCTACGCTGCATCTTCAGGG + Intronic
953388212 3:42519106-42519128 TCTGCCAGGCTCCCACCTCAAGG - Intronic
954219418 3:49143902-49143924 TGAGCTGGGCACCATCTTCAAGG - Intergenic
955844602 3:63148856-63148878 TGTGGTAGGTACCATACTCAGGG + Intergenic
956457303 3:69435054-69435076 TGTATTAGGGCCCATCCTCAAGG + Intronic
958110546 3:89137949-89137971 ATTGCTGGGCCCCATCCTCAGGG - Intronic
959153122 3:102631387-102631409 AGTGTTAGGGTCCTTCCTCAAGG - Intergenic
961378333 3:126481682-126481704 GGTGCCAGACTCCAGCCTCAGGG + Intronic
961506963 3:127376475-127376497 TTTAGTAGGCTCCATCCACAAGG - Intergenic
962385335 3:134928241-134928263 TCTGCTCGTGTCCATCCTCAGGG + Intronic
962756277 3:138467718-138467740 TGTGCTAGGCTCCATCCTCAGGG + Intronic
963309754 3:143696351-143696373 TGTGTCAGGCTCCATGCTAAAGG + Intronic
963420290 3:145053336-145053358 TGTACTTGGGTCCTTCCTCAAGG - Intergenic
964422070 3:156513614-156513636 TTTGCTCAGCTCCATCCTCTGGG + Intronic
967005941 3:185382635-185382657 AGAGCTTGGCACCATCCTCATGG + Intronic
967874286 3:194256198-194256220 TGTGCTGGGCTCCGTCCTGGGGG + Intergenic
968456465 4:703183-703205 TCTGTTCTGCTCCATCCTCAAGG + Intergenic
970441600 4:16084704-16084726 TATGCTAGACACCATCCTGAAGG - Intergenic
971586069 4:28407159-28407181 TGAGCGAGGCTCCATCGGCATGG - Intergenic
978694857 4:111565501-111565523 TGAGCTAGGCTCCATGGGCATGG - Intergenic
982835327 4:160115168-160115190 TGTGGTGGGGTCCTTCCTCAAGG - Intergenic
986742716 5:10718024-10718046 TGTAGTAGGGTCCTTCCTCAAGG - Intronic
988561926 5:32289406-32289428 TGTGGTGGGGTCCTTCCTCAAGG - Intronic
990112425 5:52344047-52344069 TGTGCAGGGTTCCATGCTCAAGG - Intergenic
991033346 5:62104447-62104469 TGTAGTAGGGTCCTTCCTCAAGG - Intergenic
994984614 5:106917197-106917219 TGTAGTGGGCTCCTTCCTCAAGG + Intergenic
995524651 5:113040756-113040778 TGTTCTTGGCTCCATCCACCTGG + Intronic
996488806 5:124068036-124068058 TGTGGTGGGGTCCTTCCTCAAGG + Intergenic
998367048 5:141638288-141638310 TGTGCTGGTCTTCTTCCTCATGG + Exonic
999102208 5:149036030-149036052 TGTGCCAGGCACCATTCTAAGGG + Intronic
999110386 5:149115439-149115461 TGTGCCAGGCACCATTCTGAGGG + Intergenic
1000565233 5:162838649-162838671 TGTGGTAGGCTACAGCATCAAGG - Intergenic
1002419523 5:179138364-179138386 TGTGCTAGGCTCGGTGCCCAGGG - Intronic
1002852570 6:1009781-1009803 TGTGATAGTTGCCATCCTCATGG + Intergenic
1003243102 6:4361441-4361463 TGTGCCAGGCCCCCTTCTCAGGG + Intergenic
1004469500 6:15916717-15916739 GGTGCTGGGCTCCAGCCCCATGG + Intergenic
1006189226 6:32197370-32197392 TGGGGTTGGCTCCAGCCTCAAGG + Exonic
1010267074 6:73879189-73879211 TGAGATAGGATCCATCCTGATGG + Intergenic
1010434212 6:75811408-75811430 TTTGCTTCTCTCCATCCTCATGG + Intronic
1010487096 6:76427833-76427855 CATGCTAGGCTACATCCACATGG - Intergenic
1012684573 6:102229485-102229507 TGAGCTACGCACCACCCTCATGG - Intergenic
1016220002 6:141656145-141656167 TGTAGTAGGGTCCTTCCTCAAGG - Intergenic
1019641926 7:2107875-2107897 TGTGCCAGGCACCATCCCCATGG - Intronic
1021716894 7:23469427-23469449 TGTGCGAGGCACCAGCCTCGCGG + Intronic
1022140261 7:27487394-27487416 GGTGCTAGGATCCAGCCCCATGG + Intergenic
1026015161 7:66666509-66666531 TGTGCCAGGCTCCCAGCTCAGGG + Intronic
1026052213 7:66956726-66956748 TGAGCTAAGCTCCAGCCTGAGGG - Exonic
1026891556 7:73985647-73985669 TGTGCCAGGCTCCCAGCTCAGGG + Intergenic
1027263951 7:76483653-76483675 TGGGCTGGGCTGCATCATCACGG - Intronic
1027315321 7:76981764-76981786 TGGGCTGGGCTGCATCATCACGG - Intergenic
1031463838 7:122083934-122083956 TGTGATATCTTCCATCCTCAAGG + Intronic
1031779320 7:125941716-125941738 TGTAATAGGGTCCTTCCTCAAGG + Intergenic
1032263366 7:130353660-130353682 TGTGCTAAGATCCATTCTGAAGG - Intronic
1032630325 7:133644001-133644023 TGCGGTAGGCTTCTTCCTCAAGG + Intronic
1036610060 8:10341969-10341991 TGTGCTAGGCTCCCAGCCCAAGG + Intronic
1037127700 8:15370774-15370796 TGTGATAGGGTTCATCCTGAAGG - Intergenic
1038119812 8:24600532-24600554 TGTTATAGGCTTCCTCCTCAAGG - Intergenic
1038723612 8:30059810-30059832 TGTGGTAGGGTTCTTCCTCAAGG + Intergenic
1039404110 8:37298120-37298142 TGTGCTCTGCTCCACCCTGAAGG + Intergenic
1042037826 8:64555959-64555981 TGTGCTAAACTCCTTCCTCTTGG - Intergenic
1046614754 8:116463767-116463789 TGGGGTAGGCTCCACCATCACGG - Intergenic
1047567097 8:126057107-126057129 AGTCCTAGGCTCCATCCACATGG + Intergenic
1047779314 8:128098503-128098525 TGTACTAATCTCCATCCCCAGGG - Intergenic
1047857883 8:128932415-128932437 TGTGCTATGCTGCCTCCACATGG + Intergenic
1048277936 8:133081235-133081257 TGTGCTAGGCTCCATGGTCATGG - Intronic
1048655512 8:136531160-136531182 TGTCCCTGGCTCTATCCTCAAGG + Intergenic
1050119244 9:2291365-2291387 TGTCCTAGGCACCATCCTCTTGG + Intergenic
1050273243 9:3968974-3968996 TGTGTTAGGCTCCATCAAAACGG + Intronic
1057544305 9:96005878-96005900 TCTACTTGGCTCTATCCTCATGG - Intronic
1058203000 9:102066956-102066978 TGTGCAAGGCTCCATGGGCATGG + Intergenic
1058538603 9:105989341-105989363 TGTACCAGGCTCCATCCCCAGGG + Intergenic
1059742217 9:117163071-117163093 TCTGCCAGGCTCCATCTACACGG + Intronic
1060741759 9:126103409-126103431 TTTGCTAGGCTCCTCCCTCAGGG - Intergenic
1061043748 9:128153541-128153563 TTCGCTAGGCTCCATCCTGGGGG - Intergenic
1061188364 9:129068224-129068246 CGTGCTGGACTTCATCCTCATGG + Exonic
1061988946 9:134147343-134147365 ACTGCTAGGCCCCATCCCCAGGG - Intronic
1062378359 9:136275118-136275140 TGGGCAAGTCTCCAACCTCAGGG + Intergenic
1062412166 9:136431103-136431125 TGTGGCAGGGTCCATCTTCAAGG - Exonic
1062445194 9:136590751-136590773 TGTTGTAGGGTCCTTCCTCAAGG - Intergenic
1202801270 9_KI270720v1_random:1457-1479 TGTCATAGGCACCATCATCACGG + Intergenic
1187577951 X:20578208-20578230 TGTGGTAAGTTCCTTCCTCATGG - Intergenic
1189795146 X:44638812-44638834 TGTTGTAGTCTCCATCTTCATGG - Intergenic
1192223984 X:69215965-69215987 TGGGCTAGGGTCTAGCCTCAGGG + Intergenic
1193979054 X:88158717-88158739 TGTGGTAGGGTCCTTCCTCAAGG - Intergenic
1195666301 X:107434119-107434141 TGTGCTGGGCTCACTTCTCAGGG + Intergenic
1197534580 X:127672017-127672039 TGTACTAGGGCCCTTCCTCAAGG - Intergenic
1202034733 Y:20620583-20620605 TGTGCTAGGCTCCGTGGGCATGG + Intergenic