ID: 962758219

View in Genome Browser
Species Human (GRCh38)
Location 3:138484680-138484702
Sequence TCCAGCTGGCCCGCAAGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962758219_962758230 16 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758230 3:138484719-138484741 GGCTTGGCGGGCCCCACACTCGG 0: 42
1: 311
2: 396
3: 316
4: 287
962758219_962758225 -6 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758225 3:138484697-138484719 GCTGGAGTTCTGGGTGGGTGTGG No data
962758219_962758226 -5 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758226 3:138484698-138484720 CTGGAGTTCTGGGTGGGTGTGGG No data
962758219_962758227 0 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758227 3:138484703-138484725 GTTCTGGGTGGGTGTGGGCTTGG 0: 19
1: 198
2: 790
3: 592
4: 743
962758219_962758229 4 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758229 3:138484707-138484729 TGGGTGGGTGTGGGCTTGGCGGG 0: 8
1: 110
2: 498
3: 595
4: 1218
962758219_962758228 3 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758228 3:138484706-138484728 CTGGGTGGGTGTGGGCTTGGCGG 0: 11
1: 132
2: 576
3: 583
4: 1197
962758219_962758231 25 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758231 3:138484728-138484750 GGCCCCACACTCGGAGCAGCCGG 0: 46
1: 263
2: 359
3: 415
4: 442
962758219_962758235 29 Left 962758219 3:138484680-138484702 CCGGTGCTTGCGGGCCAGCTGGA No data
Right 962758235 3:138484732-138484754 CCACACTCGGAGCAGCCGGCCGG 0: 32
1: 197
2: 325
3: 337
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962758219 Original CRISPR TCCAGCTGGCCCGCAAGCAC CGG (reversed) Intergenic
No off target data available for this crispr