ID: 962765633

View in Genome Browser
Species Human (GRCh38)
Location 3:138560207-138560229
Sequence GAGGGCAAACCGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1305
Summary {0: 1, 1: 1, 2: 57, 3: 368, 4: 878}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962765621_962765633 24 Left 962765621 3:138560160-138560182 CCGTGTTCATCTAATTGGGATTG 0: 1
1: 0
2: 50
3: 618
4: 1247
Right 962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG 0: 1
1: 1
2: 57
3: 368
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962765633 Original CRISPR GAGGGCAAACCGAAGGAGGG TGG Intronic
902750280 1:18503836-18503858 GAGAGAGAAACGAAGGAGGGAGG + Intergenic
904447308 1:30585579-30585601 GAGGGAAAGCTGAAGCAGGGCGG - Intergenic
904480736 1:30791724-30791746 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
905049303 1:35035620-35035642 GAGGCCACACTGAAGGAAGGTGG + Intergenic
905508718 1:38501558-38501580 GAGGTCAAATTGGAGGAGGGTGG - Intergenic
905843394 1:41205214-41205236 GAGGGCAAGCCGAAGCATGACGG + Intronic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
906568368 1:46816260-46816282 GAGGGCAGAGGGAAGGAGTGAGG + Intronic
906585704 1:46976118-46976140 GAGGGCAAGCCAAAGAAGGGTGG + Intergenic
906679387 1:47715066-47715088 GAGAGGAAACCCAATGAGGGTGG + Intergenic
906740033 1:48173516-48173538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
907015099 1:51005082-51005104 GAGGGTAAGCCAAAGCAGGGTGG + Intergenic
907565547 1:55430406-55430428 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
907953455 1:59206326-59206348 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
908598361 1:65711825-65711847 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
908601477 1:65744520-65744542 GAGGGCAAGCAGAAGCCGGGTGG - Intergenic
908813579 1:68009057-68009079 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
908916734 1:69136248-69136270 GAGGAGAAAGGGAAGGAGGGAGG + Intergenic
908976323 1:69903322-69903344 GAGGGCGAGCGGAAGCAGGGTGG + Intronic
909261311 1:73492131-73492153 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
909403215 1:75257895-75257917 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
909557398 1:76969190-76969212 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
909668105 1:78158847-78158869 GAGGGCAAGCTAAAGCAGGGCGG + Intergenic
909672325 1:78203250-78203272 GAGGGCAAGGCAAAGCAGGGTGG + Intergenic
909807960 1:79894570-79894592 GAGGGCGAGCCGAAGCATGGTGG - Intergenic
910281696 1:85508491-85508513 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910383558 1:86657589-86657611 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
910606339 1:89088831-89088853 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
910799448 1:91131106-91131128 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
910805809 1:91188934-91188956 GAGGGCAAGACGAAGCAGGGTGG - Intergenic
910915074 1:92279626-92279648 GAGGGCAAGCTGAGGCAGGGCGG + Intronic
910956835 1:92715631-92715653 GAGGGCGAGCCAAAGCAGGGCGG + Intronic
911596170 1:99800883-99800905 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
911692136 1:100845932-100845954 GAGGGCCAGCCAAAGCAGGGTGG - Intergenic
911741634 1:101392559-101392581 GAGGGCAAGAGGAAGGAGGGAGG - Intergenic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912427547 1:109608084-109608106 AAGGGCAAACCAAGGGAAGGTGG - Exonic
912675714 1:111679235-111679257 GAGGGCTAGCAGAAGCAGGGTGG + Intronic
913081277 1:115389309-115389331 GAGGGCAAGCCAAAGCAGGGCGG - Intergenic
913108742 1:115639768-115639790 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
913987982 1:143583268-143583290 GAGGACAAACCAAAGTAGGGTGG - Intergenic
914044643 1:144080533-144080555 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
914133467 1:144880153-144880175 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
914320651 1:146556412-146556434 TAGAGCAAACTGAAGAAGGGTGG - Intergenic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
914681163 1:149939186-149939208 GAGGGGCAGCCGGAGGAGGGAGG + Exonic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915976168 1:160390870-160390892 GAGGGCAAGCCAAAGCAAGGAGG - Intergenic
916312307 1:163410721-163410743 GAGAGCAGACTGAATGAGGGAGG - Intergenic
916362788 1:163990127-163990149 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
916406194 1:164500325-164500347 GAGGGCAAGCTGAAGCAAGGTGG + Intergenic
917019293 1:170569019-170569041 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917157864 1:172024647-172024669 GAGGGCAAGCCAAAGCAGGATGG + Intronic
917257584 1:173132216-173132238 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
917357680 1:174143717-174143739 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
917401460 1:174653569-174653591 GGGGGCAACCTGAAGCAGGGTGG - Intronic
917573717 1:176297065-176297087 GAGGGCAAGCCGAAGCAGGGAGG - Intergenic
917764187 1:178199275-178199297 GAGGGCGAGCTGAAGGAGGGTGG - Intronic
918316949 1:183330429-183330451 GAGAGCAGAACAAAGGAGGGTGG + Intronic
918353760 1:183684884-183684906 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
918501578 1:185201546-185201568 GAGGGCAAGCTGAAGCAGAGTGG - Intronic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
918684315 1:187396668-187396690 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
918832562 1:189416494-189416516 GAGGGCCAGCCAAAGCAGGGTGG - Intergenic
918970159 1:191404429-191404451 GAGGTCAAACTGCAGTAGGGTGG + Intergenic
919436731 1:197572087-197572109 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
919896763 1:202013798-202013820 GATGGCAAACTGATGGAGGCTGG + Intronic
919991387 1:202710260-202710282 GAGAGCGACCCGAAGGAGGCGGG + Intronic
920631783 1:207659675-207659697 GAGGGCAAGCTGAAGCAGAGCGG + Intronic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920993192 1:210959879-210959901 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
921004088 1:211075752-211075774 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
921222530 1:212983392-212983414 GAGGGCAAAGAGAGGGAGAGAGG + Intronic
921401470 1:214727933-214727955 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
921447191 1:215260753-215260775 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
921671350 1:217927265-217927287 GAGAGCAAAGAGAAGGAGAGTGG + Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
921976253 1:221206728-221206750 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
922171463 1:223159184-223159206 GAGGGGCAAGGGAAGGAGGGAGG + Intergenic
922380112 1:225014250-225014272 GAGGGCAAGCCAAAGTAGGGTGG - Intronic
922406298 1:225316647-225316669 GAGGGAGAACTGAAGCAGGGTGG - Intronic
922666454 1:227473734-227473756 GAGAGCAAGCCAAAGGAGGGTGG + Intergenic
922821463 1:228488063-228488085 GGAGGCAAGCCGCAGGAGGGAGG - Intronic
923067062 1:230527567-230527589 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
923421646 1:233822116-233822138 GAGGGCAAGTTGAAGCAGGGTGG + Intergenic
923460766 1:234207402-234207424 GAGGGAGAAAGGAAGGAGGGAGG - Intronic
923690997 1:236192635-236192657 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
924295930 1:242586785-242586807 GAGGGCAAGCCGAAGCAGGGAGG + Intergenic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1062963869 10:1592835-1592857 GAGAGGAAACCTATGGAGGGTGG - Intronic
1063126438 10:3140402-3140424 GAAGGCAAACCCACGGATGGAGG + Intronic
1065121067 10:22530754-22530776 GAGGGCAAACAGAAGCCGGGTGG - Intergenic
1065129867 10:22609841-22609863 GATGGCAGAGGGAAGGAGGGTGG - Intronic
1065364561 10:24922816-24922838 GGGGGCAAGCCGAAGTGGGGTGG + Intronic
1065621530 10:27587166-27587188 GAGGGTGAGCCAAAGGAGGGTGG + Intergenic
1065787533 10:29230143-29230165 GAGGGGAAACCAGAGGAGGTTGG - Intergenic
1065907566 10:30271962-30271984 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1066159578 10:32714246-32714268 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1066218642 10:33313990-33314012 GAAGGAAAACGAAAGGAGGGAGG - Intronic
1067162251 10:43836844-43836866 GAGAGCAAGCCAAAGCAGGGTGG - Intergenic
1067209776 10:44250199-44250221 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1067231167 10:44411691-44411713 GAGGGCCAGCCAAAGCAGGGCGG - Intergenic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1068086175 10:52375521-52375543 GAAGGCAAGCAGAAGCAGGGTGG - Intergenic
1068210065 10:53909677-53909699 GAGGGCAAGCCAAAGCACGGTGG + Intronic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1068609571 10:59043824-59043846 GAGGGCATGCCGAAGCAGAGTGG - Intergenic
1068622926 10:59207273-59207295 GAGGGCCAGCCAAAGCAGGGTGG + Intronic
1068646105 10:59470265-59470287 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1068759324 10:60690255-60690277 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1068951488 10:62782150-62782172 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1069264372 10:66438988-66439010 GAGGGTGACCCGAAGCAGGGTGG - Intronic
1069833515 10:71294968-71294990 GAGGGCAGATGGGAGGAGGGAGG - Intronic
1069944186 10:71974693-71974715 GAGGGCAGACAGCAGGTGGGCGG - Intronic
1070061649 10:72989700-72989722 GGGGGCAAGCCAAAGCAGGGCGG + Intergenic
1070999653 10:80817722-80817744 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1071189973 10:83089045-83089067 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1071272336 10:84019765-84019787 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1071838538 10:89444776-89444798 GAGGGGGAGCCGAAGCAGGGTGG + Intronic
1071876235 10:89846327-89846349 GGAGGCAAAAGGAAGGAGGGAGG + Intergenic
1072009146 10:91288268-91288290 GAGGGAAAACAGAAGAAGAGAGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072375767 10:94814079-94814101 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072389643 10:94969730-94969752 GAGGCTAAACTGAAGCAGGGAGG - Intronic
1072516265 10:96186194-96186216 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
1072872215 10:99132588-99132610 GAGAGCAAGACGAAGGAGGGTGG + Intronic
1074016848 10:109542869-109542891 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1074631503 10:115259588-115259610 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1074985257 10:118652574-118652596 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1075065942 10:119288873-119288895 AAGGGCATACCCAAGGTGGGAGG - Intronic
1075891358 10:125954004-125954026 GAGAGCACACCGAACGAAGGAGG + Intronic
1075984003 10:126767338-126767360 GAGGGCAAGCAGAACCAGGGTGG - Intergenic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076252363 10:128994644-128994666 GAGGAAAAAAGGAAGGAGGGAGG + Intergenic
1076389706 10:130090259-130090281 GAGGGACAACTGAAGCAGGGTGG + Intergenic
1077386206 11:2270667-2270689 GAGGGCGAGGCGAAGGAAGGAGG - Exonic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1077655723 11:4017044-4017066 GAGGACAAGCCAAAGCAGGGTGG - Intronic
1077803784 11:5569427-5569449 GAGGGCAAACCAAAGCAGGGTGG + Intronic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078392987 11:10952555-10952577 GAGGGTCAGCCGAAGCAGGGTGG - Intergenic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1079262616 11:18897830-18897852 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1079799858 11:24854925-24854947 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
1080117646 11:28638809-28638831 GAGGGCCAGCTGAAGCAGGGTGG + Intergenic
1080235886 11:30067595-30067617 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1080346899 11:31335374-31335396 GAGGGGAAGCTGAAGCAGGGCGG - Intronic
1080792581 11:35535056-35535078 GAGTGCAAGCTGAAGGTGGGTGG + Intergenic
1080965703 11:37211410-37211432 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081095042 11:38921610-38921632 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081221505 11:40469226-40469248 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081682456 11:45017783-45017805 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1081812204 11:45920411-45920433 TGGGGCAAACTGAAGGAGAGAGG - Intergenic
1081958972 11:47119427-47119449 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1082680406 11:56161634-56161656 GAGTGGAAACTGAAGGAGAGGGG - Intergenic
1082924307 11:58529881-58529903 GAGGGCAAGCCGAAAAAGGGTGG + Intronic
1083368421 11:62157944-62157966 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1083497023 11:63064401-63064423 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1083499097 11:63087281-63087303 GAGGGCAGGCAGAAGCAGGGTGG + Intronic
1083503490 11:63133285-63133307 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1083506960 11:63167027-63167049 GAGGGTAAGCTGAAGCAGGGTGG + Intronic
1083516310 11:63262107-63262129 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1084344868 11:68540041-68540063 GAGGGAAAATGGAAGGAGGGAGG + Intronic
1084569098 11:69948969-69948991 AAGGGGAAACCCAAGGAAGGGGG + Intergenic
1085003288 11:73061157-73061179 GAAGGCGAGCCGAAGCAGGGTGG + Intronic
1085800671 11:79586240-79586262 GAAGGCAAGCTGAAGCAGGGTGG + Intergenic
1085937236 11:81162332-81162354 GATGGCAAAGAGAAGGAGAGTGG + Intergenic
1086129117 11:83382836-83382858 GAGGGCAAGAAGAAGCAGGGTGG + Intergenic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1086456913 11:86968064-86968086 GAGGGTGAGCCGAAGTAGGGTGG - Intergenic
1086494325 11:87386668-87386690 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1086732980 11:90271526-90271548 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1086735736 11:90302924-90302946 GAGGGCGAGTCGAAGCAGGGTGG - Intergenic
1087003503 11:93445058-93445080 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1087305673 11:96486975-96486997 GGGGGCAAGCCGAAGCAGGGTGG + Intronic
1087332119 11:96793521-96793543 GAGGACAAGCCGAAGCAGGGTGG - Intergenic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1087695375 11:101370067-101370089 GAGGTCAGACCGAAGCAGGGTGG - Intergenic
1087712096 11:101566727-101566749 GAGGGCCAGCCAAAGCAGGGTGG + Intronic
1087780980 11:102301334-102301356 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1088197678 11:107293867-107293889 GAGGGCAAGAGGAAGGAGGGCGG + Intergenic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1090216347 11:124968628-124968650 GAGGGTGAACCGAAGCAGGGTGG - Intronic
1090307407 11:125703289-125703311 GAGCGCAAGCAGAAGCAGGGTGG + Intergenic
1090312614 11:125755768-125755790 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1090722943 11:129493625-129493647 GAGGGCAAGCTGAAGCAGGGAGG + Intergenic
1090725172 11:129518394-129518416 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091916317 12:4273620-4273642 GAGGGGAAAAGGAGGGAGGGAGG + Intergenic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1092629031 12:10358826-10358848 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1092661963 12:10748206-10748228 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1093402220 12:18760798-18760820 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1093597728 12:20981702-20981724 GAGGGCCAGCTGAAGCAGGGCGG - Intergenic
1093664559 12:21795848-21795870 GAGGGCAAGCCAAAGAAGGGTGG - Intergenic
1093846687 12:23980678-23980700 GAGGGGAAAACGGAAGAGGGGGG - Intergenic
1093925221 12:24902826-24902848 GAGGGCAAGGCGAAGGAGGATGG + Intronic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1094061169 12:26316601-26316623 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1094140105 12:27172172-27172194 GAGGGTGAGCCAAAGGAGGGTGG - Intergenic
1094453206 12:30603986-30604008 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1094482372 12:30895021-30895043 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
1095128266 12:38508023-38508045 GAGGGTGAGCCAAAGGAGGGCGG + Intergenic
1095230579 12:39734203-39734225 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1095356334 12:41280059-41280081 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1095406263 12:41870367-41870389 GAAGGCAAGCCAAAGCAGGGTGG + Intergenic
1095802551 12:46283657-46283679 GAGGGCAAGCCAAAGCAGGGCGG + Intergenic
1095831545 12:46591964-46591986 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
1095930852 12:47624000-47624022 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1096417291 12:51425097-51425119 GGGGGCAGAAGGAAGGAGGGTGG - Intronic
1096649800 12:53056661-53056683 GAGACCATACTGAAGGAGGGTGG - Intronic
1096846321 12:54409016-54409038 GAGGGCATAGGGAAGGAGGTGGG + Intronic
1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG + Exonic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1097700968 12:62819946-62819968 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1097749549 12:63337031-63337053 GAGGGCAAGCTGAAGTAGGGTGG + Intergenic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1097752905 12:63377928-63377950 GAGGGCAAGTCAAAGCAGGGTGG + Intergenic
1097898884 12:64853786-64853808 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1097948884 12:65403900-65403922 GAGGGGGAGCCGAAGCAGGGTGG - Intronic
1098052846 12:66472670-66472692 AAGGGCAAGCCGAAGCAGGGTGG + Intronic
1098082209 12:66799545-66799567 GAGGGGAAAAGGAAGGAGAGAGG - Intronic
1098146816 12:67506020-67506042 GAGGGCACACTGGAGTAGGGTGG + Intergenic
1098635535 12:72780040-72780062 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1098696982 12:73572254-73572276 GAAGGAAAGCCGAAGCAGGGTGG + Intergenic
1098780078 12:74676229-74676251 GAGGGCAAGCAGAAACAGGGTGG + Intergenic
1098833390 12:75390975-75390997 GAGGGAAAAACAAAGGAGGGAGG - Intergenic
1098993935 12:77096428-77096450 GAGGGCAAGCGGAAGCAGGGAGG - Intergenic
1099053545 12:77809466-77809488 GAGGGCGAACCAAAGCTGGGTGG - Intergenic
1099107809 12:78518769-78518791 GAGGGCAAACAGAAGCAGGGTGG + Intergenic
1099216608 12:79861482-79861504 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1099236185 12:80084562-80084584 GAGGGCGAACTGAAGCAGGGTGG - Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1099522432 12:83681382-83681404 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG + Intergenic
1099699036 12:86061204-86061226 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1099820319 12:87700731-87700753 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
1099897473 12:88667300-88667322 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1100110967 12:91242411-91242433 GAGGGTATGCCGAAGCAGGGTGG + Intergenic
1100593384 12:96050543-96050565 AAGGGGAAAGGGAAGGAGGGAGG + Intergenic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1100900758 12:99238069-99238091 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1100942620 12:99740744-99740766 GAGGGCAAGCTGAAGCTGGGTGG + Intronic
1103255736 12:119539978-119540000 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1103510610 12:121471185-121471207 GAGGTCAGACGGAGGGAGGGAGG - Intronic
1103877777 12:124141941-124141963 GGGGGCAACTCGAAGCAGGGAGG + Intronic
1104115690 12:125746842-125746864 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
1105645865 13:22316743-22316765 GAGAGCAAACTGAAGCAGGGTGG - Intergenic
1106025724 13:25953698-25953720 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106095071 13:26636482-26636504 GAGGGCGAGCCAAAGCAGGGCGG - Intronic
1106336112 13:28784476-28784498 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106882876 13:34150864-34150886 GAGGCAAAAATGAAGGAGGGGGG - Intergenic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107336550 13:39361913-39361935 GAGGGAAAAGGGCAGGAGGGAGG + Intronic
1107688416 13:42927443-42927465 GAGGGCTAGCAGGAGGAGGGAGG - Intronic
1108048885 13:46409386-46409408 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
1108115445 13:47122465-47122487 GTGGGCAAGCCTAAGGTGGGAGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108304519 13:49118200-49118222 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1108599784 13:51982758-51982780 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
1108674136 13:52721587-52721609 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
1109195846 13:59376967-59376989 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1109366523 13:61364060-61364082 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1109541417 13:63782732-63782754 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1109669383 13:65585316-65585338 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1109731468 13:66419500-66419522 GAGGGCAAGCAGAAGCAGAGTGG + Intronic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110389631 13:74959287-74959309 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1111469490 13:88659690-88659712 GAGGGCAGAGGGAGGGAGGGAGG + Intergenic
1112363086 13:98734452-98734474 GAGGGCAAGCTGAAGCAGAGTGG + Intronic
1112412091 13:99173291-99173313 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1112620232 13:101047220-101047242 GAGGGGGAACAGAAGCAGGGTGG - Intergenic
1113131639 13:107043228-107043250 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1113417006 13:110136492-110136514 GAGGACAACTCGAAGCAGGGAGG + Intergenic
1113518221 13:110919387-110919409 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1113842682 13:113369357-113369379 CAGGGCAAAGGGAAGGCGGGAGG - Intergenic
1113975668 13:114225627-114225649 GAGGGAGAAGAGAAGGAGGGAGG + Intergenic
1114133643 14:19821224-19821246 GAGGGTAAGCCAAAGCAGGGTGG - Intronic
1114170029 14:20262884-20262906 AAGGGCAAAGGGAAGGAGGGAGG + Intronic
1114255935 14:21001389-21001411 GAGGGGACTCTGAAGGAGGGCGG + Exonic
1114335943 14:21690109-21690131 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114341864 14:21753920-21753942 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1114433705 14:22685868-22685890 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1114817578 14:25978996-25979018 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1115116731 14:29889399-29889421 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
1115124106 14:29972178-29972200 GAGGGCAAACAGAAGCAAAGTGG + Intronic
1115162418 14:30410709-30410731 GAGGGCTAGCCAAAGCAGGGTGG - Intergenic
1115294702 14:31812607-31812629 GAGGGCAAGTGGAAGCAGGGCGG - Intronic
1115339001 14:32272570-32272592 GAGGGCACACAGAAACAGGGTGG + Intergenic
1115579163 14:34741316-34741338 GACAGCAAGCCGAAGCAGGGTGG + Intergenic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1115721178 14:36162523-36162545 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1115818399 14:37187906-37187928 GAGGGTTAACCAAAGGAGGATGG + Intergenic
1115867315 14:37761293-37761315 GAAGGCAAGCAGAAGCAGGGTGG - Intronic
1115940422 14:38602126-38602148 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1116433680 14:44873929-44873951 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1116675297 14:47898862-47898884 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1116743769 14:48792307-48792329 GAGGGCAAGCCGAAGCAAGGTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117169996 14:53084796-53084818 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1117172743 14:53117315-53117337 GAGGGCAAGCTGAAGTATGGTGG + Intronic
1117185015 14:53231391-53231413 GAGGGCAAGTAGAAGCAGGGAGG + Intergenic
1117599914 14:57364752-57364774 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117750956 14:58923725-58923747 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1117900674 14:60529262-60529284 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1118516178 14:66530754-66530776 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1118559927 14:67067926-67067948 GAGGGCGAGTCGAAGCAGGGCGG - Intronic
1119018564 14:71085138-71085160 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
1119930610 14:78542660-78542682 GAGGGCAAGCTGAAGTAGGGTGG - Intronic
1120065720 14:80038947-80038969 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1120271863 14:82322389-82322411 GTGGGCAAGCAGAAGCAGGGTGG - Intergenic
1120554198 14:85908266-85908288 GAAGGCAAACCAAAGCAGAGTGG - Intergenic
1120843244 14:89105121-89105143 GATGGCAAGCCAAAGCAGGGTGG - Intergenic
1121049179 14:90809116-90809138 TAAGGCAGACCCAAGGAGGGTGG - Intronic
1122409105 14:101517039-101517061 AAGGGGAAACAGAAGAAGGGAGG + Intergenic
1122420163 14:101571441-101571463 GGTGGGAAACCCAAGGAGGGAGG + Intergenic
1122443403 14:101750223-101750245 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1202936348 14_KI270725v1_random:91540-91562 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1124195173 15:27619293-27619315 GAGGGCAAACTGGAGTAGGGGGG - Intergenic
1124593247 15:31071554-31071576 GAAGGCCATCAGAAGGAGGGTGG - Intronic
1124724714 15:32145893-32145915 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
1124893859 15:33757988-33758010 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125330085 15:38573864-38573886 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125784210 15:42301206-42301228 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1125970027 15:43904018-43904040 GAAGGCACACCGAGGGAGAGGGG + Intronic
1125984678 15:44038699-44038721 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1126074543 15:44896510-44896532 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1126087092 15:45021058-45021080 GAGGGTGAGCCGAAGCAGGGAGG - Intergenic
1126451023 15:48809925-48809947 GAGGGCATCTTGAAGGAGGGTGG - Intronic
1126952283 15:53894135-53894157 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1127029938 15:54850878-54850900 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1127137968 15:55944158-55944180 GAGGGCAAGCCGAAGCAGGATGG + Intronic
1127157962 15:56149548-56149570 GAGGGCGAGGCGAAGCAGGGTGG + Intronic
1127452608 15:59131474-59131496 GAGGGCGAGCAGAAGTAGGGTGG + Intergenic
1127764613 15:62172926-62172948 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1128339884 15:66813971-66813993 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1128827683 15:70735193-70735215 GAGGGCAGACAGAGGGATGGGGG + Intronic
1129156322 15:73720522-73720544 GAGGGCATATCCAAGGATGGGGG - Intergenic
1129495680 15:75977609-75977631 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1129499241 15:76019639-76019661 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
1131590768 15:93746548-93746570 GAGAGCAAACAAAAGCAGGGTGG + Intergenic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1132287981 15:100679530-100679552 GAGGGCAACTCAAAGCAGGGCGG - Intergenic
1133517270 16:6521503-6521525 GAGGGAAAAGCGAAGGGGAGGGG - Intronic
1133647740 16:7780288-7780310 GTTGACAAAACGAAGGAGGGTGG + Intergenic
1133745019 16:8679778-8679800 GAGGGCAAAGTGAAGAAGTGAGG - Intronic
1134312942 16:13092793-13092815 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1135807476 16:25555986-25556008 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1135897295 16:26419385-26419407 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1136186354 16:28591009-28591031 GAGGACAAAGGGAAGGAGTGGGG - Intronic
1136230530 16:28883004-28883026 GAGGGCAGAAGGGAGGAGGGAGG + Intronic
1137325020 16:47425417-47425439 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1137720053 16:50622490-50622512 GAAGGCAAACAGAGGGAAGGAGG - Intronic
1137784296 16:51125190-51125212 GAGGGCAGAGGGAAGGTGGGAGG + Intergenic
1137970072 16:52975866-52975888 GAGGGCGAGTCGAAGCAGGGTGG - Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138843739 16:60539567-60539589 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1139222146 16:65194541-65194563 GAGGGCGAGCAGAAGAAGGGTGG - Intergenic
1140012882 16:71153693-71153715 TAGAGCAAACTGAAGAAGGGTGG + Intronic
1140165154 16:72543351-72543373 GAGGGCGAGCGGAAGCAGGGTGG + Intergenic
1140419440 16:74806548-74806570 CAGGGCAACTCGAAGCAGGGAGG - Intergenic
1140781435 16:78300492-78300514 GAGGGGAGAGGGAAGGAGGGAGG - Intronic
1140906998 16:79417565-79417587 GACAGACAACCGAAGGAGGGAGG + Intergenic
1141225814 16:82113881-82113903 GAGGGCATACAGGAGTAGGGTGG - Intergenic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1142220389 16:88851530-88851552 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1142317191 16:89355215-89355237 GAGGGCTCACGGAGGGAGGGCGG + Intronic
1142796246 17:2309582-2309604 GAGTGAATACCTAAGGAGGGAGG - Intronic
1143164250 17:4890006-4890028 GAGGGCACAGGGAATGAGGGGGG - Intronic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1145284867 17:21497929-21497951 GAGGGAGAACTGAAGAAGGGTGG + Intergenic
1146678981 17:34793456-34793478 GAAGGCAAAGCCAAGGAGGCTGG + Intergenic
1146700059 17:34949494-34949516 GAGGGAAGAAGGAAGGAGGGAGG + Intronic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1147866278 17:43554714-43554736 AAGGGAAAACTGATGGAGGGGGG + Intronic
1147919063 17:43905554-43905576 GAAGGCAAAGGGAAGAAGGGTGG - Intronic
1148564038 17:48622731-48622753 AAGGGCAAAGGAAAGGAGGGAGG + Exonic
1149168238 17:53779838-53779860 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1149197018 17:54133151-54133173 GAGGGCAAGCCAAAGCAGGGCGG - Intergenic
1149222804 17:54435691-54435713 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1149905891 17:60526085-60526107 GGGGGCAAACTGAGGGACGGCGG + Exonic
1149932094 17:60767167-60767189 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1150025802 17:61673194-61673216 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1150062252 17:62078525-62078547 AAGGGCAAACAGAGGGATGGTGG - Intergenic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150545690 17:66155236-66155258 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1151763342 17:76119810-76119832 GAAGGCAAAGTGAAGGAGGTCGG + Intronic
1153059459 18:980389-980411 GAGGGCAAGCCGAAGCAGGTTGG - Intergenic
1153313495 18:3700418-3700440 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1153702527 18:7711177-7711199 GAGGGCAAGCAGAAACAGGGTGG + Intronic
1153743381 18:8151951-8151973 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1153845212 18:9043227-9043249 GAGGGCAAAACGAGTGAGTGAGG + Intergenic
1154101629 18:11479728-11479750 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1154288817 18:13086479-13086501 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1155091448 18:22515307-22515329 GAGTCCAAACTGATGGAGGGAGG - Intergenic
1155100414 18:22605144-22605166 GAGGCCAGACCAAAGGAGGGAGG + Intergenic
1155114141 18:22748455-22748477 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1155384847 18:25266595-25266617 GAGGGCAAGCTGATGCAGGGTGG + Intronic
1155665260 18:28299810-28299832 GAAGGCAAGCCAAAGCAGGGTGG - Intergenic
1155677861 18:28451241-28451263 GAGGGCAAACCTAAGGAAGTAGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1156188462 18:34690429-34690451 GAGGGCCAGCCGAAGCAGGGTGG - Intronic
1156261806 18:35451468-35451490 GAGGGAAAAGGGTAGGAGGGAGG + Intronic
1156337114 18:36181999-36182021 GGGGGCAAAGAGTAGGAGGGAGG + Intergenic
1156443896 18:37219800-37219822 GAGGGCAAGCCGAAGCAAGGTGG - Intronic
1157071660 18:44416065-44416087 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1157442490 18:47721511-47721533 GAAGGAAAAGCGAAGGAAGGAGG + Intergenic
1157595854 18:48863131-48863153 CAGGACATACCGACGGAGGGAGG - Intronic
1157787980 18:50503054-50503076 GACGGCAAGCCAAAGCAGGGTGG - Intergenic
1158103829 18:53861499-53861521 GAGGGCAGAAGGAAGGAGGGAGG + Intergenic
1158124853 18:54089983-54090005 GAGGGCAAAAGCAAGGAAGGGGG + Intergenic
1158399116 18:57104800-57104822 GAGGGCAAGCAAAAGCAGGGTGG - Intergenic
1158470078 18:57728453-57728475 GAGGGCAAAGAGAGGAAGGGAGG + Intronic
1158825877 18:61218480-61218502 GAGGCCATACGGAAGTAGGGTGG + Intergenic
1158853288 18:61517432-61517454 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1159386052 18:67726322-67726344 GAGAGCAAATAGAAGCAGGGTGG - Intergenic
1159562104 18:70007104-70007126 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1159570830 18:70110409-70110431 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1159645870 18:70917031-70917053 GAGGGCAAGCTGAATCAGGGTGG - Intergenic
1159661305 18:71098416-71098438 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1159690673 18:71483304-71483326 GAGGGCGAGCCGAAGCAGGGAGG - Intergenic
1160017748 18:75157457-75157479 GAGGTCATACTGGAGGAGGGTGG + Intergenic
1160932532 19:1577419-1577441 GAAGGGAAACCGAGGCAGGGGGG + Exonic
1161116824 19:2501870-2501892 GAGCGCAGACTGATGGAGGGAGG - Intergenic
1161535794 19:4817860-4817882 GAGGGCAAAGCCGAGGATGGTGG + Exonic
1164047622 19:21555931-21555953 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1164092952 19:21977422-21977444 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
1164416513 19:28050382-28050404 GAAGGCAAGCCAAAGCAGGGTGG + Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166240235 19:41486502-41486524 GAGGGCTAGCTGAAGCAGGGTGG + Intergenic
1166749013 19:45155964-45155986 GAGGGCAGATGGGAGGAGGGTGG - Intronic
1167698388 19:51027891-51027913 GAAGGGAAACTGGAGGAGGGAGG - Intronic
1168530937 19:57128061-57128083 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1202684201 1_KI270712v1_random:33952-33974 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
925627946 2:5860864-5860886 GAGGGCAAGCAGGAGCAGGGTGG - Intergenic
925692256 2:6537510-6537532 GAGGGCAAGCCAAAACAGGGTGG + Intergenic
926074777 2:9933131-9933153 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
926542401 2:14197542-14197564 GAGGGCAGAGAGAAGGAGTGAGG - Intergenic
926944062 2:18168501-18168523 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
928462609 2:31489234-31489256 GAGGGCAAGCTGAAGCAGGGGGG + Intergenic
928481058 2:31684004-31684026 GAGGGCAAGATGAAGTAGGGAGG - Intergenic
928750564 2:34466362-34466384 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
930223386 2:48767867-48767889 GAGGGCAGGCAGAAGCAGGGTGG - Intronic
930269016 2:49233634-49233656 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
930274778 2:49298614-49298636 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
930860422 2:56065844-56065866 GAGGGAAAACAGAAGCAGAGTGG - Intergenic
931030316 2:58168295-58168317 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
931886781 2:66626272-66626294 GAGGGCACGCCAAAGCAGGGTGG - Intergenic
932051727 2:68405045-68405067 GAAGGCAAGCCGAAGCAGTGTGG + Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932323904 2:70842343-70842365 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
932327972 2:70876046-70876068 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
932539925 2:72641235-72641257 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
933413290 2:81951500-81951522 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
934247518 2:90320900-90320922 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
934261806 2:91481701-91481723 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
934304846 2:91812680-91812702 TAGGACAGCCCGAAGGAGGGGGG - Intergenic
934328411 2:92040070-92040092 TAGGACAGCCCGAAGGAGGGGGG + Intergenic
934561822 2:95317471-95317493 GAAGGCAAACCCAAGGCAGGAGG + Intronic
934617034 2:95778617-95778639 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
934643859 2:96045942-96045964 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934837276 2:97602036-97602058 GAGGGTGAGCCGAAGCAGGGCGG - Intergenic
934871732 2:97872591-97872613 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
935273976 2:101460215-101460237 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
935325750 2:101935514-101935536 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
936640360 2:114304599-114304621 GAAGGCAAGCCAAAGCAGGGTGG - Intergenic
936649910 2:114413974-114413996 GAGGGTAAGCCAAAGCAGGGAGG - Intergenic
936807820 2:116358576-116358598 GAGGGCAAGTCGAAGCAGGGTGG + Intergenic
936909842 2:117579381-117579403 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
937000054 2:118457577-118457599 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
937143047 2:119618432-119618454 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
937526055 2:122771923-122771945 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
937606225 2:123804544-123804566 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938115451 2:128600161-128600183 AAGGGCAGAAGGAAGGAGGGAGG + Intergenic
938236503 2:129710400-129710422 GAGGGCAGAGGGAGGGAGGGAGG + Intergenic
938874510 2:135518552-135518574 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
939382119 2:141448692-141448714 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
939876791 2:147586753-147586775 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
939946839 2:148421270-148421292 GAGGGAAAGCCAAAGCAGGGTGG + Intronic
940417899 2:153443343-153443365 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940594091 2:155767353-155767375 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
940757856 2:157704323-157704345 AAGGGCGAGCCGAAGCAGGGTGG + Intergenic
940821321 2:158359527-158359549 GACAGCAAGCCGAAGCAGGGTGG + Intronic
940964436 2:159821883-159821905 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941518799 2:166511843-166511865 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
941523746 2:166581365-166581387 GAGGGCAAGCTGAAACAGGGCGG + Intergenic
941845208 2:170125746-170125768 GAGAGCGAGCCGAAGCAGGGTGG + Intergenic
941896053 2:170630078-170630100 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
942010950 2:171761830-171761852 AAGGGCGAGCCGAAGCAGGGTGG - Intergenic
942065846 2:172270703-172270725 GAGGGCAAGCAGAAGCAGTGTGG - Intergenic
942199821 2:173559758-173559780 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
942455531 2:176135941-176135963 GAGGGGAAACCGAAAGTGGTTGG + Intergenic
942744071 2:179212168-179212190 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
942873540 2:180765246-180765268 GAGGGCAAGCTGAAGTAGAGCGG + Intergenic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
942951997 2:181731794-181731816 GAGGGCAAGCCAAAGCAGGGCGG + Intergenic
943074725 2:183179821-183179843 GAGGGCAAGCAGAAACAGGGTGG - Intergenic
943094803 2:183416464-183416486 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
943350636 2:186792859-186792881 GTGGGCGAGCCGAAGCAGGGTGG + Intergenic
943408853 2:187520441-187520463 GAGGGCAAGCCAAGGCAGGGTGG - Intronic
943660399 2:190554009-190554031 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
943716741 2:191160715-191160737 GAGGACAAGCCGAAGCAGGGTGG + Intergenic
943866550 2:192931133-192931155 GAGGGCAAGCCAAGGCAGGGCGG - Intergenic
944291952 2:198018077-198018099 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
944374729 2:199028621-199028643 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
944635321 2:201670904-201670926 AAGGGTAAACCAAAGCAGGGTGG + Intronic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
944832728 2:203549113-203549135 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
944910941 2:204309910-204309932 GAGGGCAAAAGGATGGAGGGAGG + Intergenic
945116800 2:206416045-206416067 GAGGGCAAGCCGAAGCAGGGCGG - Intergenic
945482287 2:210357986-210358008 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
945945125 2:215988240-215988262 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946696897 2:222368725-222368747 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
946794029 2:223330655-223330677 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947225938 2:227839983-227840005 AAGGGCAAGCCAAAGCAGGGTGG - Intergenic
947275876 2:228391217-228391239 GAGGGCAAGCTGAAGCAGGGGGG - Intergenic
947344171 2:229173743-229173765 CAGGGCACACCGAAGTGGGGAGG - Intronic
947681503 2:232037830-232037852 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
948738647 2:240027454-240027476 GAGGGAAAACGGAAAAAGGGGGG - Intergenic
949045986 2:241872873-241872895 GAAGGCAAAGAGAAGGAAGGTGG + Exonic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169541628 20:6606108-6606130 AAGGGAAAAGGGAAGGAGGGCGG - Intergenic
1170229480 20:14028717-14028739 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1170266476 20:14471218-14471240 GAGGGCTAGCCGAAGCAGGGTGG - Intronic
1170294155 20:14806299-14806321 GAGGGCGACCAGAAGCAGGGTGG + Intronic
1170720521 20:18873694-18873716 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1170727425 20:18942151-18942173 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1171000766 20:21413672-21413694 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1171011701 20:21512676-21512698 GAGGGAAATCCGTAGGAGTGGGG + Intronic
1171081795 20:22194276-22194298 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1171443564 20:25186824-25186846 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1171906731 20:30905458-30905480 GTAGGCCAACCGGAGGAGGGTGG - Intergenic
1172466688 20:35160788-35160810 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1172872429 20:38144073-38144095 GAGGACAGACCGGAGGACGGGGG + Intronic
1174172202 20:48624625-48624647 GAAGGCATACCGAAGCTGGGGGG + Exonic
1174265129 20:49325767-49325789 GAGGGCAAGAAGGAGGAGGGAGG - Intergenic
1174589795 20:51635838-51635860 GAGGGAAAAAGGAAGGAAGGAGG + Intronic
1175184953 20:57173817-57173839 GTGGGCAAACCGAGGCATGGAGG - Intronic
1175778872 20:61669564-61669586 GAAGGAAAACTGAAGAAGGGTGG + Intronic
1175988632 20:62776754-62776776 GAGGGCAGGGCGGAGGAGGGAGG + Intergenic
1176587149 21:8598059-8598081 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1176891697 21:14327002-14327024 GAGGGCACGCAGAAGCAGGGTGG + Intergenic
1177129593 21:17240317-17240339 GAGGGCAAGACAAAGCAGGGTGG + Intergenic
1177136296 21:17308446-17308468 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
1177184275 21:17776037-17776059 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1177313154 21:19423999-19424021 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1177352882 21:19967699-19967721 GAGGTCATACTGAAGTAGGGTGG + Intergenic
1177540911 21:22493315-22493337 GCGGGCAAGCAGAAGCAGGGTGG + Intergenic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1180269980 22:10575056-10575078 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1180587927 22:16909807-16909829 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1180596152 22:16974857-16974879 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1182057727 22:27373196-27373218 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1184997343 22:48217993-48218015 GAGTGCAAACAGCAGGAAGGAGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185117539 22:48946143-48946165 CAGGGCATACGGAGGGAGGGAGG + Intergenic
949154923 3:816344-816366 GAGGGCAAGCCAAAGCAGGATGG + Intergenic
949226886 3:1705531-1705553 GAGGGTGAACTGAAGCAGGGTGG + Intergenic
949440101 3:4071319-4071341 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
949580682 3:5384534-5384556 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
949583278 3:5412366-5412388 GAAGGCAAGCCAAAGAAGGGTGG + Intergenic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949846037 3:8371958-8371980 GAGGGAGAGCCGAAGCAGGGTGG + Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950562064 3:13736680-13736702 GAGGGCAAGCCGAAGCAGGTTGG - Intergenic
950590738 3:13934475-13934497 GAGGACGAACCCAAGGACGGGGG + Intergenic
950704505 3:14771594-14771616 GAGGCCATACTGGAGGAGGGTGG - Intronic
951012118 3:17693254-17693276 GAAGGCAAGCTGAAGCAGGGTGG + Intronic
951237795 3:20254976-20254998 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
951310820 3:21124694-21124716 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
951347322 3:21561441-21561463 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
951840413 3:27027804-27027826 GAAGGCAAACAGATGCAGGGTGG + Intergenic
953047153 3:39304373-39304395 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953219097 3:40951243-40951265 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
953653157 3:44823984-44824006 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
954198006 3:49007691-49007713 GAGGGCCAACCTGAAGAGGGCGG + Intronic
954501035 3:51014137-51014159 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
954507566 3:51091852-51091874 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
954513900 3:51153478-51153500 GAGGGCAAGCCGAAGCAGTGTGG - Intronic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954530980 3:51320165-51320187 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
954571891 3:51647967-51647989 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
955439671 3:58942419-58942441 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
955454051 3:59100804-59100826 GAGAGCAATCAGAAGCAGGGTGG - Intergenic
956080199 3:65549290-65549312 GAGGGAAGACGGAAAGAGGGAGG - Intronic
956207803 3:66772117-66772139 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
956301989 3:67781911-67781933 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
956314603 3:67920198-67920220 GAAGGGAAACCAAAGCAGGGTGG - Intergenic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957850514 3:85800702-85800724 GAGGGCGAGCAGAAGTAGGGTGG - Intronic
957993338 3:87654169-87654191 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
958094772 3:88929659-88929681 GAGGGCAAGCCGAAGGAGGGTGG + Intergenic
958257512 3:91341516-91341538 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
958434615 3:94081204-94081226 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
958694643 3:97511476-97511498 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
958706861 3:97666645-97666667 GAGGTCATACTGAAGTAGGGTGG - Intronic
959045254 3:101466855-101466877 GAGGGCAAGCTGAAGCAGGGCGG + Intronic
959170878 3:102842260-102842282 GAGGGCGAGCCAAAGTAGGGTGG - Intergenic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959494869 3:107038496-107038518 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
959734897 3:109647734-109647756 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
959796276 3:110432410-110432432 GAGGGGAGAGGGAAGGAGGGGGG - Intergenic
959815753 3:110671581-110671603 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
959847993 3:111056503-111056525 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
959974435 3:112442532-112442554 GAGGGCAGAGAGAGGGAGGGGGG + Intergenic
960177195 3:114531834-114531856 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
960226988 3:115179908-115179930 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
960276845 3:115738464-115738486 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
960478762 3:118162747-118162769 GAGGGCAAGCCAAAGCAGAGGGG + Intergenic
960653888 3:119981368-119981390 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
960655890 3:120003917-120003939 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
960836098 3:121908354-121908376 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
960913119 3:122668967-122668989 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
961310498 3:125996396-125996418 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962181131 3:133207278-133207300 GAAGGCAAGCAGAAGCAGGGTGG - Intronic
962377790 3:134873160-134873182 GAGAGAAAAAGGAAGGAGGGAGG + Intronic
962512258 3:136114111-136114133 GAGGGTGACCCGAAGCAGGGTGG + Intronic
962634856 3:137319879-137319901 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
962665963 3:137654052-137654074 GAGGGTGAGCCGAAGAAGGGTGG + Intergenic
962765633 3:138560207-138560229 GAGGGCAAACCGAAGGAGGGTGG + Intronic
962766932 3:138574113-138574135 AAGGGCGAGCCGAAGCAGGGTGG + Intronic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963401818 3:144807281-144807303 GAGAGCGAACAGAAGCAGGGTGG - Intergenic
963410933 3:144926793-144926815 GAGGGCGAACAGAAGCAGGGTGG - Intergenic
963481515 3:145879976-145879998 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963871314 3:150417420-150417442 GAAGACAAAACAAAGGAGGGAGG + Intronic
963980150 3:151528549-151528571 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
963998639 3:151740288-151740310 GAGGGCGAACAGAAGCAGGGTGG - Intronic
964371447 3:156004381-156004403 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
964450700 3:156810011-156810033 GAGGGCAAGCCCAAGGATGCAGG - Intergenic
964649188 3:158991866-158991888 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
964701746 3:159575075-159575097 GAGGGCGAGCCAAAGCAGGGCGG - Intronic
965091161 3:164163727-164163749 GAGGGCTAGCAGAAGCAGGGTGG - Intergenic
965163880 3:165169792-165169814 GAGGGCAAGCCAAAGCATGGCGG - Intergenic
965221359 3:165931244-165931266 GAGGGTGAGCCGAAGGAGGGTGG + Intergenic
965487962 3:169301895-169301917 GGGGGCAACACAAAGGAGGGGGG + Intronic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
966250997 3:177865570-177865592 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
966255005 3:177907976-177907998 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
966291108 3:178360956-178360978 GAGGGCAAGCAGAAGCATGGTGG + Intergenic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
966351758 3:179038732-179038754 GAGGACGAACTGAAGCAGGGTGG + Intronic
966477537 3:180367498-180367520 GAGAGCAAGCCAAAGCAGGGTGG + Intergenic
966533385 3:181004803-181004825 GATGGCAAGCCGAAGCAAGGTGG - Intergenic
966583196 3:181591391-181591413 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
966638000 3:182157002-182157024 GAGGGCAAGCTGAAGCAAGGTGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967244936 3:187477172-187477194 GAGGACAACCCGAAGCAGGGAGG - Intergenic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967638528 3:191834319-191834341 GAGGGCAAGCCTAAGCAGGGTGG + Intergenic
968408658 4:365303-365325 GAGGGCAAGCTGAAACAGGGTGG - Intronic
968829186 4:2923433-2923455 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
968860693 4:3166911-3166933 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969204867 4:5635910-5635932 GTGGGCAAACCGAAGCCCGGAGG - Intronic
969909265 4:10428369-10428391 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
969920054 4:10530008-10530030 GAAGGAAAAGGGAAGGAGGGAGG - Intronic
970182787 4:13416908-13416930 GATGGCAAGCCGAAGCAGGGCGG + Intronic
970496227 4:16628774-16628796 GAGGGTGAGCCGAAGAAGGGTGG + Intronic
970655431 4:18225342-18225364 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
970685161 4:18559259-18559281 GAAGGCAAGCCAAAGCAGGGTGG + Intergenic
970714643 4:18907607-18907629 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
970917433 4:21352297-21352319 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
970975766 4:22041160-22041182 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971430144 4:26556816-26556838 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
971437204 4:26640577-26640599 GAGGGTGAGCCGAAGCAGGGAGG + Intronic
971673689 4:29595965-29595987 GAGGGCAAGCCGAAGCACGGTGG - Intergenic
971749121 4:30623873-30623895 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
971851579 4:31991825-31991847 CAGGGCAACTCGAAGGAGGGTGG + Intergenic
972219227 4:36935467-36935489 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972743362 4:41909810-41909832 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
972755477 4:42041904-42041926 GAGGGTGACCCGAAGCAGGGTGG + Intronic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973137649 4:46727699-46727721 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
973614664 4:52666353-52666375 GAGGAAAAAGGGAAGGAGGGAGG + Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973715303 4:53670108-53670130 GAGGGCAAACTGAAGCAGCGTGG - Intronic
973798307 4:54451044-54451066 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
973883501 4:55297300-55297322 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
974106324 4:57473187-57473209 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
974196824 4:58585585-58585607 GAGGGTGAGCCAAAGGAGGGTGG - Intergenic
974264060 4:59560900-59560922 GAGGGCAAGCAGAAGCAGGTGGG - Intergenic
974265823 4:59584541-59584563 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
974491717 4:62572211-62572233 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
974566865 4:63589749-63589771 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
974792924 4:66713738-66713760 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
974871714 4:67652696-67652718 GAGGGCGAGCCGAAGCAGGGCGG + Intronic
974944108 4:68505335-68505357 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
975104033 4:70548405-70548427 GAGGGCAAGCCAAAGTAGGGTGG + Intergenic
975149506 4:71005260-71005282 GAGGCCAAGCAGAAGCAGGGTGG - Intronic
975219487 4:71797642-71797664 GAGGGCGAGCCAAAGCAGGGCGG - Intronic
975291152 4:72679481-72679503 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
975350503 4:73340340-73340362 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
975425050 4:74215491-74215513 GAGGGCGAACTGAAGCAGGGTGG - Intronic
975528698 4:75378372-75378394 GAGTGTGAACCGAAGCAGGGTGG + Intergenic
975533141 4:75421228-75421250 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
975711413 4:77163650-77163672 GAAGGCATTCCGAAGGAGGAGGG + Intronic
975807326 4:78126373-78126395 GAGGGCAAGCCGATGCAGGGTGG - Intronic
975844066 4:78506723-78506745 GAGGGCAAGCTGAAGCAGGGAGG - Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976114770 4:81715091-81715113 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
976394823 4:84544798-84544820 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
976438204 4:85043488-85043510 AAGGGCGACCCGAAGCAGGGTGG + Intergenic
976451546 4:85196489-85196511 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
976506509 4:85853448-85853470 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
976548899 4:86371727-86371749 GAGGGCAGACCAAAGCAGGGTGG + Intronic
976861415 4:89671271-89671293 GAGGGCAAACCTAAGTAGGGTGG + Intergenic
977219836 4:94325755-94325777 GAGGGCAAGCTGAAGCAGTGTGG - Intronic
977326517 4:95580771-95580793 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
977561431 4:98537286-98537308 GAGGGCAAGCCGAAGCAGGGTGG - Intronic
977630735 4:99239582-99239604 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
977771756 4:100868776-100868798 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
977986085 4:103385240-103385262 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
978078964 4:104568444-104568466 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
978090212 4:104706702-104706724 GAGGGCAAGCCAAAGTATGGTGG + Intergenic
978313203 4:107409135-107409157 GAGGGCAAGCCAAAGCAGGTTGG + Intergenic
978464498 4:108994126-108994148 GAGGGCTACCTGAAGCAGGGAGG + Intronic
978552207 4:109939512-109939534 GAGGGCCAGCCGAAGCAGGGTGG - Intronic
978831555 4:113091833-113091855 GAGCGCAAACTGAAAGAGGGTGG - Intronic
978845651 4:113269570-113269592 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
979115199 4:116814962-116814984 GAGGGTGATCCGAAGCAGGGTGG + Intergenic
979128574 4:117009404-117009426 GATGGAAAAGGGAAGGAGGGAGG + Intergenic
979310484 4:119197828-119197850 GAGGGCGAGCTGCAGGAGGGCGG + Intronic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979668362 4:123336990-123337012 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
979966070 4:127077635-127077657 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
980100405 4:128536176-128536198 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
980157718 4:129126815-129126837 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980253789 4:130350193-130350215 GAAGGAAAAAGGAAGGAGGGAGG - Intergenic
980285764 4:130776880-130776902 GAGGGCGAGCCGAAGTAGGGTGG + Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980634009 4:135474256-135474278 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980733316 4:136849253-136849275 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981411175 4:144434777-144434799 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
981414961 4:144482607-144482629 GAGGGCGAGCCGAAGCAGGGAGG + Intergenic
981498253 4:145417554-145417576 GAGGGAAGAAGGAAGGAGGGAGG + Intergenic
981629622 4:146804092-146804114 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
981795031 4:148585892-148585914 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
981859932 4:149341829-149341851 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
981861728 4:149363328-149363350 GGGGGCAGACTGAAGTAGGGTGG + Intergenic
981939843 4:150271052-150271074 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
982323790 4:154108627-154108649 GAGAGCAAGCTGAAGCAGGGTGG + Intergenic
982625503 4:157760806-157760828 CAGGGCAAGCCAAAGCAGGGTGG - Intergenic
982725682 4:158903272-158903294 GAGGGCAAGTAGAAGGAGGGTGG - Intronic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983047563 4:163005016-163005038 GAGGGCAAGCCGAAGCAGGATGG - Intergenic
983299108 4:165902576-165902598 GAAGGCAAGCCAAAGCAGGGTGG - Intronic
983388112 4:167092138-167092160 GAGGGCAAGCTGAAGTAGGGTGG + Intronic
983543207 4:168935121-168935143 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
983594264 4:169448827-169448849 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
983602834 4:169549253-169549275 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
983949540 4:173622854-173622876 GAGGGCAAGTGGAAGCAGGGTGG - Intergenic
983958892 4:173728266-173728288 GAGGGCAAGACAAAGGAGGGTGG - Intergenic
984195137 4:176650102-176650124 GAGGTCACACTGGAGGAGGGTGG - Intergenic
984224390 4:177017357-177017379 GAGGGTGAACCGAAGCAGGGCGG + Intergenic
984354113 4:178636826-178636848 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984618551 4:181926857-181926879 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985194107 4:187408726-187408748 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
986313354 5:6571075-6571097 GAGGGAAGAGGGAAGGAGGGTGG + Intergenic
986323115 5:6649729-6649751 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986378915 5:7163097-7163119 GATGGCCAACAGAAGCAGGGTGG - Intergenic
986440957 5:7781386-7781408 GAGGTCATGCTGAAGGAGGGTGG + Intronic
986581576 5:9271721-9271743 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986759642 5:10868400-10868422 GTGGGCAAAGCCAAGTAGGGAGG - Intergenic
986805126 5:11301966-11301988 GTGGGTAAACTGGAGGAGGGTGG + Intronic
986838892 5:11672901-11672923 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
987747965 5:22001631-22001653 GAGGGCAGAGGGAAGGAGGAGGG - Intronic
987837968 5:23186297-23186319 GAGGGCGAACCAAAGCAGGGCGG + Intergenic
987949846 5:24660730-24660752 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
988187872 5:27889856-27889878 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
988402023 5:30775282-30775304 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
988687575 5:33539978-33540000 GAGGGCGAGCGGAAGCAGGGCGG + Intronic
988771177 5:34434754-34434776 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
988867776 5:35354339-35354361 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
988975143 5:36508164-36508186 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
989320795 5:40131346-40131368 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
989825260 5:45847646-45847668 GAGGGAGAACAGAAGCAGGGTGG + Intergenic
989981893 5:50655475-50655497 GAGGGAAGAAGGAAGGAGGGAGG - Intergenic
990239153 5:53799519-53799541 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
990745941 5:58959380-58959402 GAGGGCGAGCCGAAGGAGGGTGG - Intergenic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
991236617 5:64406809-64406831 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
991280811 5:64910924-64910946 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
991425048 5:66482198-66482220 GAGGGCAAGCCGAAGCAAGGCGG + Intergenic
991768143 5:70011435-70011457 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
991847381 5:70886517-70886539 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
991934678 5:71789944-71789966 GATGGCAAGCCAAAGCAGGGTGG + Intergenic
992025992 5:72669619-72669641 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
992038962 5:72809324-72809346 GAGGGCGAGTCGAAGCAGGGTGG - Intergenic
992254971 5:74912065-74912087 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
993266402 5:85732009-85732031 GAGGGCAAACCAAAGCAGGGTGG + Intergenic
993345621 5:86778438-86778460 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
993381946 5:87218163-87218185 GAAGGCAAGCAGAAGCAGGGTGG - Intergenic
993410563 5:87567817-87567839 GAGGGCAAGCAGAAGCAAGGGGG - Intergenic
993455206 5:88120084-88120106 GAGGGCAAGTCAAAGCAGGGTGG + Intergenic
993948055 5:94138420-94138442 GAGGGTAAGCCAAAGCAGGGCGG - Intergenic
993961046 5:94296698-94296720 GAGGGCAAGCAGAAGTGGGGAGG - Intronic
994005247 5:94829263-94829285 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
994233615 5:97336682-97336704 GAGGGCAAGCGGAAGAAGGGTGG - Intergenic
994575067 5:101567449-101567471 GAAGGCAAACCAAAGCAGGGTGG - Intergenic
994609441 5:102018420-102018442 GAGGGCCAGCCGAAGCAGGGCGG + Intergenic
995093990 5:108213583-108213605 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
995162585 5:108998444-108998466 GAGGGCGAGCCGAAGAAGGATGG - Intronic
995229240 5:109739921-109739943 GAGGGCTGACAGATGGAGGGAGG + Intronic
995301833 5:110594151-110594173 GAGGGCAAGCAGAAGCATGGTGG + Intronic
995471147 5:112503438-112503460 GAGGGCAAGCCAAAGGAGGGAGG + Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
995612276 5:113923449-113923471 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
995620532 5:114021094-114021116 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
996781951 5:127197287-127197309 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
997187724 5:131898898-131898920 GAAGGCAAGCCGAAGGAGGGCGG - Intronic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997220442 5:132157658-132157680 GAGGGCGACCTGAAGCAGGGTGG - Intergenic
997252200 5:132397972-132397994 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
997343934 5:133171198-133171220 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
997497070 5:134337325-134337347 GAGGGCGAGCCGAAGCAGGGAGG - Intronic
997702994 5:135917897-135917919 TAGGGCAGAGGGAAGGAGGGAGG + Intergenic
998022547 5:138782308-138782330 GAGGGGAAACCCAAGAAAGGTGG + Intronic
998691905 5:144596290-144596312 GAGGGTGAACCGAAGCAGGGTGG - Intergenic
998772746 5:145564948-145564970 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
998780236 5:145647833-145647855 GAGGGCAAGCCAAAGTAGGGTGG - Intronic
998934109 5:147216152-147216174 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
998972873 5:147611480-147611502 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999965559 5:156806006-156806028 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1000068928 5:157721087-157721109 GAGGGAGAGCCGAAGCAGGGTGG + Intergenic
1000214250 5:159139692-159139714 GAGGGTAAGCCAAAGCAGGGCGG + Intergenic
1000547977 5:162625556-162625578 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1000820269 5:165973952-165973974 GAGGGCAACGAGAAGCAGGGTGG - Intergenic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1000996186 5:167960994-167961016 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1001362757 5:171103898-171103920 GAGGGCGAGCCGAAGAAGGGTGG - Intronic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001756654 5:174175466-174175488 GAGGTCAAACTGGAGGAGAGTGG - Intronic
1002658549 5:180773377-180773399 GGGGGCAACTCGAAGCAGGGAGG - Intergenic
1002944713 6:1750428-1750450 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1003647463 6:7925842-7925864 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1003713590 6:8620090-8620112 GAGGGTTAGCCGAAGCAGGGTGG - Intergenic
1004027906 6:11837034-11837056 GAGGGCAAGCCAAAGGGGGGTGG + Intergenic
1004220359 6:13741736-13741758 GAGGTCATACTGAAGCAGGGAGG - Intergenic
1004944549 6:20596937-20596959 GGGGGCAAGCCGAAGCAGGGCGG - Intronic
1005778437 6:29162307-29162329 GAGGGCAAGCAGAAGAAGGGTGG - Intergenic
1005791988 6:29312522-29312544 GAGGGCTAGCCGAAGCAGGGTGG - Intergenic
1005959053 6:30683602-30683624 GAGGGGAAACCCAGGGAGGAAGG + Intronic
1006198466 6:32263590-32263612 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1006271615 6:32970357-32970379 TAGGGCAAACCCCGGGAGGGCGG - Intronic
1006371924 6:33650146-33650168 AAGGGCAGAGAGAAGGAGGGTGG - Intronic
1007858049 6:44878770-44878792 GAGGGCAAGCCGAAGCAGGGTGG + Intronic
1008176281 6:48271341-48271363 AAGGGCAAATAGAAGCAGGGTGG - Intergenic
1008209474 6:48703112-48703134 GATGCCAAACTGAAGGTGGGAGG + Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008558583 6:52700564-52700586 GTGGGCAGACCGCGGGAGGGTGG + Intergenic
1008575558 6:52856853-52856875 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1008782813 6:55127367-55127389 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1008865334 6:56203812-56203834 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1008896920 6:56566493-56566515 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1008997793 6:57679507-57679529 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009186285 6:60578845-60578867 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009290009 6:61869703-61869725 GAGGGTGAGCCGAAGCAGGGTGG + Intronic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009335972 6:62491866-62491888 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009536589 6:64896279-64896301 GAGGGCAAGCAGATGCAGGGTGG + Intronic
1009709703 6:67300925-67300947 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1009795143 6:68456535-68456557 GAGGGTGAACCAAAGCAGGGTGG - Intergenic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1009998202 6:70920394-70920416 GAGGGCAAGCCGAAGCAGGGCGG - Intronic
1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG + Intergenic
1010006148 6:70997839-70997861 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1010039235 6:71361627-71361649 GAGGGCAAGCTGAAGCAAGGTGG - Intergenic
1010276257 6:73971966-73971988 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1010615280 6:78005471-78005493 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1010747205 6:79577793-79577815 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1010755724 6:79664138-79664160 GAGGGCGAGCTGAAGCAGGGTGG - Intronic
1010961486 6:82151063-82151085 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1011020784 6:82809787-82809809 GAGGGCAAACAGAAGCAGGGTGG - Intergenic
1011065417 6:83320999-83321021 GAGGGCAAGGAGAAGCAGGGTGG + Intronic
1011086439 6:83546490-83546512 GAAGGCGAACTGAAGCAGGGTGG + Intergenic
1011137489 6:84115874-84115896 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1011174017 6:84540651-84540673 GACGGCAAGCTGAAGCAGGGTGG + Intergenic
1011301522 6:85879201-85879223 GAGGGCAAGCGGAAGTAGGGTGG - Intergenic
1011302724 6:85892937-85892959 GAGGGCAAGCCGAAGCAGAGTGG - Intergenic
1011333583 6:86236363-86236385 GAGGGCAAGCCAAAGTAGGGTGG + Intergenic
1011348016 6:86392744-86392766 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011417700 6:87139829-87139851 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1011776872 6:90740040-90740062 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1012585289 6:100914105-100914127 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1012870803 6:104670927-104670949 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1013389111 6:109665500-109665522 GATGCCAAACCAAATGAGGGTGG - Intronic
1013452903 6:110303008-110303030 GAGGGCGAGCAGAAGTAGGGTGG + Intronic
1013578354 6:111507696-111507718 GAGGGCAAGCCAAAGCAAGGCGG - Intergenic
1013672543 6:112421241-112421263 GAAGGCAAGCAGAAGCAGGGTGG + Intergenic
1013989728 6:116239519-116239541 GAGGGCCTGCCTAAGGAGGGTGG + Intronic
1014113302 6:117645454-117645476 GAGGACAAGCCAAAGGAGGGTGG + Intergenic
1014134386 6:117871268-117871290 GGGGGCAAGCGGAAGGAGTGGGG + Intergenic
1014177111 6:118342838-118342860 GAGGGCAAGCAGAAGCATGGTGG - Intergenic
1014212339 6:118720180-118720202 GAGGGAAAAAGGAAGGAAGGAGG - Intergenic
1014422906 6:121267294-121267316 GAGTGTGAACCGAAGCAGGGCGG + Intronic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014568960 6:122986019-122986041 GAGGGCAAGCCAAAGCAGAGTGG + Intergenic
1014868231 6:126558850-126558872 GAGGGCCAGCCGAAGCAGGGTGG + Intergenic
1014907078 6:127043393-127043415 CAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1014922347 6:127228332-127228354 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1014942300 6:127456950-127456972 GAGGAGAAAGGGAAGGAGGGAGG - Intronic
1014968244 6:127782593-127782615 GAGGGCAAGCCAAAGCAGGGCGG - Intronic
1015123171 6:129723085-129723107 AAGGGCAGAGCAAAGGAGGGTGG + Intergenic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015419158 6:132986442-132986464 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1015623484 6:135156631-135156653 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1016006046 6:139090401-139090423 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1016102023 6:140114870-140114892 GAGGGCAAGCCAAAGCAGGGCGG + Intergenic
1016111383 6:140229983-140230005 GAGGGCGAGCCGAAGCAGGATGG + Intergenic
1016338607 6:143035500-143035522 GAGGGCTAGCCGAAGGAGGGTGG - Intergenic
1016436919 6:144047169-144047191 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1016593050 6:145766940-145766962 GAGGGCAGGCCGAAGCAGGGTGG - Intergenic
1016655681 6:146515658-146515680 GGGGGCAAGCCAAAGCAGGGCGG - Intergenic
1017302849 6:152882820-152882842 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1017571327 6:155748427-155748449 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1017968791 6:159290832-159290854 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1018004999 6:159613495-159613517 CAGGACAAACCAAAGGATGGAGG + Intergenic
1018682702 6:166277165-166277187 GTGGCCAAGCCGAAGGAGGCAGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019633612 7:2063852-2063874 GAGGGCAGAGCGAGGGAGGCTGG - Intronic
1019635762 7:2074820-2074842 GAGGGGAAACCGGAGGCTGGGGG + Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019818253 7:3217413-3217435 GAGGGCAAAGCCAAGGTGAGGGG - Intergenic
1020333315 7:7041978-7042000 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020391501 7:7662610-7662632 GAGGGCGAACAGAAACAGGGTGG - Intronic
1020487749 7:8739442-8739464 GAAGGCAATCAGAAGCAGGGTGG - Intronic
1020590145 7:10124989-10125011 GAGGGCAAGTGGAAGCAGGGTGG - Intergenic
1020609049 7:10372700-10372722 GAGGGCAAGCTGAAGTAGGGAGG + Intergenic
1020659547 7:10966065-10966087 GAGGACAAGCCAAAGCAGGGTGG - Intergenic
1020715974 7:11675113-11675135 GAGGGCAAGCAGAAGCAGGTGGG + Intronic
1020874353 7:13674313-13674335 GAGGGCAAGCAGAAGCAAGGTGG - Intergenic
1021014579 7:15517511-15517533 GAGGCCAAGCAGAAGCAGGGTGG + Intronic
1021071607 7:16248734-16248756 GAGGGCGAGCTGAAGAAGGGTGG + Intronic
1021167100 7:17354752-17354774 GAGGGCAAGCTGAAACAGGGTGG - Intergenic
1021207772 7:17806802-17806824 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1021306674 7:19040220-19040242 GAGGGCTAGCTGAAGCAGGGTGG - Intronic
1021749429 7:23780132-23780154 GAGGGCAAGCAAAAGCAGGGTGG - Intronic
1021782350 7:24118410-24118432 GAAGGCAAGCTGAAGCAGGGTGG - Intergenic
1022481825 7:30749281-30749303 GAAGGCAAACCTAAGGATAGTGG + Intronic
1022866942 7:34431472-34431494 GAAGGCAAGCCGAAGCAGGGCGG + Intergenic
1023146184 7:37153307-37153329 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1023456874 7:40349056-40349078 GAGGATATACAGAAGGAGGGTGG - Intronic
1023910047 7:44547293-44547315 GAGGGGGAAGGGAAGGAGGGAGG + Intergenic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024998604 7:55295208-55295230 GAGGGTGAACTGAAGCAGGGTGG - Intergenic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026638797 7:72106647-72106669 GGGGGAAAAGGGAAGGAGGGAGG + Intronic
1027446161 7:78275242-78275264 GAGGGCAAGCCAAAGCAGGGTGG - Intronic
1027510407 7:79072087-79072109 GAGGGCAAGCTGAAGCAGAGTGG - Intronic
1027637000 7:80688887-80688909 GAAGGCGAACCAAAGCAGGGTGG + Intergenic
1027778309 7:82492999-82493021 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1027790311 7:82633242-82633264 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1027864656 7:83630081-83630103 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1028080266 7:86567202-86567224 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1028378029 7:90167992-90168014 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1028396072 7:90369791-90369813 GAGGGCAAACCAAAGCAGGGTGG - Intronic
1028476416 7:91258172-91258194 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1028526283 7:91790619-91790641 AAGGGCAAGCCAAAGCAGGGCGG + Intronic
1028692094 7:93664008-93664030 GAGGGCAAGCTGAAGCAGGGCGG - Intronic
1029816886 7:103106089-103106111 GAGGGTGAGCCAAAGGAGGGTGG + Intronic
1029845335 7:103406476-103406498 GAGGGCAAGCTGAACCAGGGTGG - Intronic
1030325944 7:108218228-108218250 GAGGGCGAGCCGAAGCAGGGTGG - Intronic
1030331778 7:108278729-108278751 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
1030533952 7:110743633-110743655 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1030781053 7:113600590-113600612 GAGTGCAAGCAGAAGCAGGGTGG + Intergenic
1031051507 7:116950348-116950370 GAGGGGGAAGGGAAGGAGGGAGG - Intergenic
1031365933 7:120900892-120900914 GAGGGCAAGCCAAAGCGGGGGGG + Intergenic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032312668 7:130802820-130802842 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1032436789 7:131907339-131907361 GAGGGCAAAGGGAAGGAGGGAGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1033887493 7:145966733-145966755 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1035998403 8:4574419-4574441 GAGGGTAAGCAGAAGAAGGGTGG - Intronic
1036553689 8:9838512-9838534 GAGGGCGAGCCGAAGCAGAGTGG + Intergenic
1037286743 8:17309653-17309675 AAGGGGAAACCGAAGGAAAGAGG + Intronic
1037557679 8:20041289-20041311 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1037578909 8:20233136-20233158 GAGGTCACACTGAAGTAGGGTGG + Intergenic
1037664458 8:20956199-20956221 GAGGGCAAACCAAAACAGGGTGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037776240 8:21837806-21837828 GTGGGCAGAGGGAAGGAGGGAGG - Intergenic
1037804294 8:22050531-22050553 GAGGTCAAAGAGAGGGAGGGAGG - Intronic
1038407623 8:27333851-27333873 GAGGGCTAAGGGAGGGAGGGAGG - Intronic
1039145110 8:34438440-34438462 GAGGGCAAGCTGAAGCAGCGTGG + Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1039347662 8:36725903-36725925 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1039832336 8:41225149-41225171 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040473012 8:47752132-47752154 GAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1040473936 8:47760418-47760440 GAGGGCAAGCCAAAGCAGAGTGG - Intergenic
1040556665 8:48485727-48485749 GAGGGCAAGCTGAAGCTGGGTGG + Intergenic
1040779815 8:51094823-51094845 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1040943130 8:52852939-52852961 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041287222 8:56273386-56273408 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041666238 8:60447910-60447932 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1041836557 8:62223270-62223292 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1041838416 8:62242532-62242554 GAAGGCCATCCGAAGCAGGGTGG - Intergenic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1042308758 8:67358915-67358937 GAGGGCGATCTGAAGCAGGGCGG - Intergenic
1042327324 8:67541793-67541815 GAGGGCGAGCCAAAGCAGGGTGG - Intronic
1042375045 8:68040433-68040455 GAAGGCTAAAGGAAGGAGGGAGG - Intronic
1042480768 8:69300177-69300199 GAGGCAAAACCCAAGGAGGTTGG + Intergenic
1042614295 8:70631862-70631884 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1042627244 8:70771208-70771230 GAGGGTAAGCTGAAGCAGGGTGG - Intronic
1042931258 8:74016033-74016055 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
1042946110 8:74156350-74156372 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043132685 8:76481132-76481154 GAAGGAAAAGCGAATGAGGGAGG + Intergenic
1043165883 8:76902067-76902089 GAGGGCAAGCGGAAGCAGGGTGG - Intergenic
1043938911 8:86174358-86174380 AAGGGCAAGCCGAAGCAGGGCGG - Intergenic
1044503477 8:92990598-92990620 GAGGGCAAGCTGAAGCAGCGTGG + Intronic
1044577010 8:93780341-93780363 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1045050665 8:98321259-98321281 GAGGCCAAAGCAAAGGAGGCAGG - Intergenic
1045123365 8:99063241-99063263 GAGGGCAAGCCGAAGCAGGGCGG + Intronic
1045212023 8:100108519-100108541 GAGGGCAAGCCAAAGCAGGGTGG + Intronic
1045973258 8:108103627-108103649 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1046048058 8:108986856-108986878 GAGGGCAAGCAGAATCAGGGTGG - Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046219864 8:111200498-111200520 GAGGGCCAGCCAAAGCAGGGTGG + Intergenic
1047129319 8:122001413-122001435 GAGGGCAAGCTGAAGCAAGGCGG + Intergenic
1047473479 8:125202187-125202209 GAGGGCAAGGTGAAGTAGGGCGG - Intronic
1047931513 8:129732831-129732853 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048466999 8:134674112-134674134 GAGGGCAAGCCAAAGCAAGGTGG + Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048717933 8:137288449-137288471 GAGGTTAAATCAAAGGAGGGGGG - Intergenic
1049115031 8:140678763-140678785 TAGGGCAAACCGAATGTGTGAGG + Intronic
1049164028 8:141115803-141115825 GAGTGCAAAGCCAAGGTGGGCGG + Intergenic
1049181599 8:141225858-141225880 GAGGGCAAAGGGGAGGAGGCTGG - Intronic
1049268973 8:141684144-141684166 GAGGGCTTCCCCAAGGAGGGTGG - Intergenic
1049762300 8:144336957-144336979 GAGGGCGGGCCGAGGGAGGGAGG + Intergenic
1050031680 9:1393250-1393272 GAGGGCTAGCAGAAGCAGGGTGG + Intergenic
1050234474 9:3563176-3563198 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1050369113 9:4902379-4902401 GAGGGCAAGCCAAAGCAGGGAGG - Intergenic
1050386958 9:5101052-5101074 GAGGGCAAGTTGAAGCAGGGCGG + Intronic
1050591115 9:7161302-7161324 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050597263 9:7216405-7216427 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1050604200 9:7283676-7283698 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1050952112 9:11610750-11610772 GAGGGGAAAGAGAAGGAGAGAGG - Intergenic
1050963256 9:11765413-11765435 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051353828 9:16223227-16223249 GAGGGCAAGCCAAAGCAGGCTGG + Intronic
1051447541 9:17156026-17156048 GAGGGCTAGCCGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051712382 9:19945302-19945324 GAGGGGAAAAGGAAGGAGGGAGG + Intergenic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1052052800 9:23866893-23866915 GAGGGTAAGCCAAAGCAGGGTGG - Intergenic
1052096678 9:24391776-24391798 GAGGGCGAGCCGAAGCAGGGTGG - Intergenic
1052146992 9:25061627-25061649 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052241285 9:26277249-26277271 GAGGGCAAGCAAAAGAAGGGTGG + Intergenic
1052281303 9:26735869-26735891 GAGGGCAAGCCAAAGCAGGTTGG - Intergenic
1052336480 9:27324904-27324926 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1052668091 9:31519659-31519681 GAGGTCAAGCCGAAGCAGGGTGG - Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053586545 9:39464487-39464509 GAGGGCAGACGGCAGGAGGTGGG + Intergenic
1053696841 9:40647385-40647407 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054308092 9:63446618-63446640 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054406825 9:64770609-64770631 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054440450 9:65256075-65256097 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054489957 9:65765849-65765871 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1054579762 9:66900746-66900768 GAGGGCAGACGGCAGGAGGTGGG - Exonic
1055061345 9:72072342-72072364 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1055125802 9:72717055-72717077 GAGGGCAAGCCAAAGTAGGGTGG - Intronic
1055210237 9:73782887-73782909 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1055239144 9:74163321-74163343 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1055617051 9:78083749-78083771 GAGGACAAGCCAAAGGAGGGCGG + Intergenic
1055642881 9:78334481-78334503 GAGGGCGAGCTGAAGCAGGGCGG + Intergenic
1055708252 9:79031885-79031907 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1055768946 9:79695317-79695339 GTAGGCACACCAAAGGAGGGAGG - Intronic
1055894759 9:81162432-81162454 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1056000904 9:82215740-82215762 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1056176874 9:84044362-84044384 GAGGGCAAGTCAAAGCAGGGTGG - Intergenic
1056302713 9:85258445-85258467 CATGGCAAACAGAAGCAGGGTGG - Intergenic
1056320827 9:85433238-85433260 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1056997864 9:91479948-91479970 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1057646074 9:96876488-96876510 AAAGGCAAACTGATGGAGGGAGG - Intergenic
1057698186 9:97342147-97342169 GAGGGTGAGCCGAAGAAGGGCGG - Intronic
1057708070 9:97412132-97412154 GCGGGGAAACCGAAAGTGGGCGG + Exonic
1057758124 9:97853204-97853226 GAGGGGAAGCCGGCGGAGGGAGG + Intergenic
1057895507 9:98905525-98905547 GAGGGTGCAGCGAAGGAGGGAGG - Intergenic
1058011957 9:99988702-99988724 GAGGGCGAGCCGAAGCAGGGTGG + Intronic
1058074664 9:100638266-100638288 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1058270994 9:102971344-102971366 GAGGGCCAACCCAGGCAGGGAGG - Intergenic
1058393098 9:104520008-104520030 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1058421866 9:104840385-104840407 GCGGGCATCCCGAGGGAGGGGGG - Exonic
1059864712 9:118501486-118501508 GAGGGCAAGCTGAAGCAGGGCGG - Intergenic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061556507 9:131373316-131373338 GAGGGCCAGCCGAAGCGGGGTGG - Intergenic
1062480954 9:136751086-136751108 GAGGGGAAGAAGAAGGAGGGAGG + Intergenic
1062560119 9:137137896-137137918 GAGAGCCAACAGAAGGAGTGAGG + Intergenic
1202779293 9_KI270717v1_random:21044-21066 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1203617107 Un_KI270749v1:75774-75796 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1185911061 X:3981847-3981869 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1186330972 X:8533999-8534021 GAGGGAAGAATGAAGGAGGGAGG + Intronic
1186332833 X:8554292-8554314 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1186354158 X:8772972-8772994 GAGGGCAAGCCAAAGCAAGGTGG + Intergenic
1186443224 X:9603966-9603988 GAGGTCAAATCGCAGCAGGGTGG - Intronic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1187046990 X:15656544-15656566 GTGGGCAGACTGAAGGAGTGTGG - Intronic
1187705457 X:22005425-22005447 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1187829207 X:23363625-23363647 GAGGGTGAGCCGAAGCAGGGCGG - Intronic
1187840019 X:23477200-23477222 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1188123054 X:26334150-26334172 GAGGGTGAGCCGAAGCAGGGCGG + Intergenic
1188130097 X:26420061-26420083 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1188470298 X:30530473-30530495 GAGGGCACAACCAAGGAGGGTGG - Intergenic
1188922010 X:35987903-35987925 GAAGGCAAGCCGAAGCAGGGTGG - Intronic
1189419417 X:40843444-40843466 GAGGGTAAAGGGAAGAAGGGTGG - Intergenic
1189590567 X:42506871-42506893 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1189754051 X:44252977-44252999 GAGGGCGAGCTGAAGCAGGGTGG + Intronic
1189937674 X:46086971-46086993 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1189978506 X:46486361-46486383 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1190341549 X:49300306-49300328 GAAGGCAAGCCGAAGTAGAGTGG - Intronic
1190505792 X:51125074-51125096 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1190622209 X:52298870-52298892 GAGGGCCAGCTGAAGTAGGGCGG + Intergenic
1190683451 X:52849531-52849553 GAGGGCGAGCTGAAGCAGGGCGG - Intergenic
1190959850 X:55235116-55235138 GAGGGCAAGCAGAATCAGGGTGG - Intronic
1190977196 X:55417039-55417061 GAGTTCAAACCAAAAGAGGGTGG + Intergenic
1191003836 X:55689100-55689122 GAGGGTAAGCCGAAGCAGGGTGG - Intergenic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191115334 X:56846582-56846604 GAGGGCAAGCAGAAACAGGGTGG + Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191138820 X:57094483-57094505 GAGGGCGAGCCGAAGCAGGGTGG + Intergenic
1191194346 X:57705526-57705548 GTGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191601852 X:63017183-63017205 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191631868 X:63330871-63330893 GAGGGCGAGCCGAGGCAGGGTGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191733441 X:64363760-64363782 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1191762698 X:64662437-64662459 GAGGGAAAGCCAAAGCAGGGTGG - Intergenic
1191764453 X:64682111-64682133 GAGGGAAAACAGAACTAGGGAGG + Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191873016 X:65765674-65765696 GAGGGCGAGCTGAAGCAGGGTGG - Intergenic
1191984762 X:66968296-66968318 GAGGGTGAACCAAAGCAGGGTGG + Intergenic
1192395851 X:70780478-70780500 GAGGGTGAACCAAAGCAGGGTGG + Intronic
1192524468 X:71829810-71829832 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1192612877 X:72585592-72585614 GAGGGCAAGCCAAAACAGGGTGG + Intronic
1192637240 X:72831246-72831268 GAGGGCAAGCCAGAGCAGGGTGG - Intronic
1192644474 X:72889568-72889590 GAGGGCAAGCCAGAGCAGGGTGG + Intronic
1192712695 X:73607784-73607806 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1192727469 X:73768066-73768088 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1192960561 X:76126613-76126635 GAGAGCAAAGAGAAGCAGGGTGG + Intergenic
1192966632 X:76183566-76183588 GTGGGCAAACTGAAGCAAGGTGG - Intergenic
1192977741 X:76303715-76303737 GAGGGCGAGCCAAAGCAGGGTGG - Intergenic
1193013914 X:76710688-76710710 GAGGTCATACTGAAGTAGGGTGG - Intergenic
1193065357 X:77253906-77253928 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1193161454 X:78233352-78233374 GAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1193167249 X:78294953-78294975 GAGGGCAAGCCGAAGTGGGGCGG - Intronic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193284702 X:79697581-79697603 GAGGGCAAGCTAAAGCAGGGTGG - Intergenic
1193334564 X:80273571-80273593 GAGAGCAAGCTGAAAGAGGGTGG + Intergenic
1193338534 X:80319417-80319439 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193361770 X:80587174-80587196 AAGGGCAAGCAGAAGTAGGGTGG - Intergenic
1193382252 X:80828472-80828494 GAGGGCAAGCAGAAACAGGGTGG - Intergenic
1193402567 X:81063841-81063863 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193419959 X:81271220-81271242 GAGGGCAAGCCAAAGCAGAGTGG - Intronic
1193435992 X:81475426-81475448 GAGGGCTAGCTGAAGCAGGGCGG - Intergenic
1193477202 X:81981601-81981623 GAGGGCAAGCTGAAGAAGGGTGG + Intergenic
1193516884 X:82476696-82476718 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1193616080 X:83689187-83689209 GAGGGAAAGCCAAAGCAGGGTGG - Intergenic
1193646698 X:84079160-84079182 GAGGGCGAGCTGAAGGAGGGTGG + Intronic
1193685346 X:84571324-84571346 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1194119077 X:89938039-89938061 GAAGGCGAGCCGAAGCAGGGTGG - Intergenic
1194242484 X:91469628-91469650 GAGGGCGAACAGAAGCAGGTGGG + Intergenic
1194254791 X:91622625-91622647 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1194515412 X:94845486-94845508 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1194576431 X:95619228-95619250 GAGGGCAAGCCAAAGCAGGATGG - Intergenic
1194652527 X:96533113-96533135 GAGGGCGAAGCGAAGCAGGGTGG + Intergenic
1194677886 X:96815499-96815521 GAGGGCGAGACGAAGCAGGGCGG - Intronic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1194772363 X:97921190-97921212 GAGGGCGAGCCGAAGCAGGGCGG + Intergenic
1194798481 X:98241138-98241160 CAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1194954499 X:100162856-100162878 GAGGGCAAGCAGAAGCGGGGTGG - Intergenic
1194963921 X:100266673-100266695 GAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1195127516 X:101822807-101822829 GAGGGCGAGCGGAAGCAGGGTGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195345041 X:103941006-103941028 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1195351272 X:103998711-103998733 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1195508228 X:105684203-105684225 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1195622007 X:106966456-106966478 GAGGGCAAGCCAAAGCAGGGCGG + Intronic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195842670 X:109191853-109191875 GAGGGTGAGCCGAAGCAGGGTGG + Intergenic
1195947368 X:110229677-110229699 GAGGGCGAGCTGAAGCAGGGCGG + Intronic
1196158975 X:112461951-112461973 GAGGGCGAGCCAAAGCAGGGTGG + Intergenic
1196281265 X:113825811-113825833 GAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1196308151 X:114128099-114128121 GAAGGCAAGCCAAAGCAGGGTGG - Intergenic
1196312301 X:114183328-114183350 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197142115 X:123129458-123129480 GAGGGCAAGCCGAAGCAAGGTGG + Intergenic
1197191011 X:123648152-123648174 GAGGGCGAGCCAAAGCAGGGTGG + Intronic
1197350214 X:125373032-125373054 GAGGGCGAGCCGAAACAGGGTGG - Intergenic
1197395676 X:125923625-125923647 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1197505917 X:127305663-127305685 GAGGGCGAACAGAAGCAGGGTGG + Intergenic
1197906161 X:131428110-131428132 GAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1198002358 X:132451964-132451986 GAGGGCAAGCTGAAGCAGGGTGG - Intronic
1198062520 X:133061646-133061668 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1198072014 X:133158903-133158925 GAGGGCAAGCCGAAGCAGGCTGG + Intergenic
1198259104 X:134950614-134950636 GAGGGCGAGCCGAAACAGGGTGG + Intergenic
1198293737 X:135263788-135263810 GAGGGCGAGCTGAAGCAGGGCGG - Intronic
1198572316 X:137971122-137971144 GAGGGCAAGCCAAAGCAGGGTGG + Intergenic
1198678665 X:139157952-139157974 GAGGGCAAGCTGAAGCAGGGTGG + Intronic
1198725866 X:139676295-139676317 GAGGGTGAACTGAAGCAGGGTGG - Intronic
1198757936 X:140000755-140000777 GAGGGCAAGCAGAAGTAGGGTGG + Intergenic
1199094398 X:143723319-143723341 GAGGGCAAGCCAAAGGAGGGTGG + Intergenic
1199300328 X:146205729-146205751 GAGTGCAAACAAAAGGATGGTGG + Intergenic
1199436528 X:147819213-147819235 GAGGGCGAGCTGAAGCAGGGTGG + Intergenic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1200388581 X:155918603-155918625 GAGGGTGAGCCGAAGCAGGGTGG - Intronic
1200405949 Y:2811580-2811602 GAGGGTAAGCTGAAGCAGGGTGG - Intergenic
1200573577 Y:4862228-4862250 GAGGGTGAGCCGAAGCAGGGTGG - Intergenic
1201194569 Y:11479325-11479347 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1201376662 Y:13330374-13330396 GAGGGCAAACAGAAGCAGGGTGG + Intronic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201702555 Y:16900472-16900494 GAGGGAAATGGGAAGGAGGGAGG - Intergenic
1201946313 Y:19514661-19514683 GAGGGCAAGCAGAAGCAAGGTGG + Intergenic
1201961983 Y:19690690-19690712 GAGGGCAAGCCAAAGCAGGGTGG - Intergenic
1202163644 Y:21963249-21963271 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202227712 Y:22623116-22623138 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic
1202315445 Y:23573062-23573084 GAGGGGAGAGGGAAGGAGGGAGG - Intergenic
1202555356 Y:26097535-26097557 GAGGGGAGAGGGAAGGAGGGAGG + Intergenic