ID: 962769306

View in Genome Browser
Species Human (GRCh38)
Location 3:138597513-138597535
Sequence CATTGTGCACTCAGGGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
962769306_962769309 -7 Left 962769306 3:138597513-138597535 CCGAGCTCCCTGAGTGCACAATG No data
Right 962769309 3:138597529-138597551 CACAATGTCTGTCCCTTTTAAGG No data
962769306_962769310 -6 Left 962769306 3:138597513-138597535 CCGAGCTCCCTGAGTGCACAATG No data
Right 962769310 3:138597530-138597552 ACAATGTCTGTCCCTTTTAAGGG No data
962769306_962769314 25 Left 962769306 3:138597513-138597535 CCGAGCTCCCTGAGTGCACAATG No data
Right 962769314 3:138597561-138597583 ACTAAAGATTTCACATGAAAGGG 0: 98
1: 59
2: 33
3: 40
4: 318
962769306_962769313 24 Left 962769306 3:138597513-138597535 CCGAGCTCCCTGAGTGCACAATG No data
Right 962769313 3:138597560-138597582 CACTAAAGATTTCACATGAAAGG 0: 91
1: 64
2: 36
3: 36
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
962769306 Original CRISPR CATTGTGCACTCAGGGAGCT CGG (reversed) Intergenic
No off target data available for this crispr